Incidental Mutation 'R1591:Fgfr1'
ID 175499
Institutional Source Beutler Lab
Gene Symbol Fgfr1
Ensembl Gene ENSMUSG00000031565
Gene Name fibroblast growth factor receptor 1
Synonyms Hspy, Fr1, FGFR-I, Fgfr-1, Flt-2, Eask
MMRRC Submission 039628-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1591 (G1)
Quality Score 189
Status Validated
Chromosome 8
Chromosomal Location 26008808-26067819 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26062736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 671 (G671D)
Ref Sequence ENSEMBL: ENSMUSP00000136640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084027] [ENSMUST00000117179] [ENSMUST00000119398] [ENSMUST00000179592] [ENSMUST00000167764] [ENSMUST00000178276]
AlphaFold P16092
Predicted Effect probably damaging
Transcript: ENSMUST00000084027
AA Change: G660D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081041
Gene: ENSMUSG00000031565
AA Change: G660D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 169 237 4.09e-9 SMART
IGc2 268 348 1.26e-9 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
TyrKc 478 754 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117179
AA Change: G658D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113909
Gene: ENSMUSG00000031565
AA Change: G658D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 46 108 2.94e-10 SMART
low complexity region 124 138 N/A INTRINSIC
IGc2 167 235 4.09e-9 SMART
IGc2 266 346 1.26e-9 SMART
transmembrane domain 373 395 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
TyrKc 476 752 1.51e-155 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119398
AA Change: G571D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113855
Gene: ENSMUSG00000031565
AA Change: G571D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 80 148 4.09e-9 SMART
IGc2 179 259 1.26e-9 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133936
Predicted Effect probably damaging
Transcript: ENSMUST00000179592
AA Change: G671D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136640
Gene: ENSMUSG00000031565
AA Change: G671D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 121 2.94e-10 SMART
low complexity region 137 151 N/A INTRINSIC
IGc2 180 248 4.09e-9 SMART
IGc2 279 359 1.26e-9 SMART
transmembrane domain 386 408 N/A INTRINSIC
low complexity region 450 464 N/A INTRINSIC
TyrKc 489 765 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167764
AA Change: G571D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131343
Gene: ENSMUSG00000031565
AA Change: G571D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178276
AA Change: G571D

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137515
Gene: ENSMUSG00000031565
AA Change: G571D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
IGc2 78 146 4.09e-9 SMART
IGc2 177 255 1.22e-7 SMART
transmembrane domain 286 308 N/A INTRINSIC
low complexity region 350 364 N/A INTRINSIC
TyrKc 389 665 1.51e-155 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211419
Predicted Effect probably benign
Transcript: ENSMUST00000138104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145218
Meta Mutation Damage Score 0.9615 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die around gastrulation and show defective patterning of axial structures. Hypomorphic and selectively ablated mutations exhibit a wide range of abnormalities affecting diverse structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,957,505 (GRCm39) Q201K probably benign Het
Acacb A T 5: 114,341,484 (GRCm39) I829F possibly damaging Het
Acvr1b G T 15: 101,091,905 (GRCm39) V62L probably benign Het
Adam6b A T 12: 113,453,452 (GRCm39) I90F probably benign Het
Adgrf1 T C 17: 43,621,872 (GRCm39) L703P probably damaging Het
Arf3 T C 15: 98,640,669 (GRCm39) probably benign Het
Asns T C 6: 7,678,007 (GRCm39) D357G probably damaging Het
Atr T C 9: 95,827,438 (GRCm39) M2461T probably damaging Het
B3galt4 G A 17: 34,169,813 (GRCm39) R142C probably damaging Het
Bod1l T C 5: 41,976,563 (GRCm39) I1584V probably benign Het
Bub3 T C 7: 131,163,337 (GRCm39) probably null Het
Camkk2 A G 5: 122,895,621 (GRCm39) probably null Het
Cand1 G T 10: 119,047,774 (GRCm39) T572K possibly damaging Het
Caprin2 A T 6: 148,774,606 (GRCm39) S235R possibly damaging Het
Cdh24 T C 14: 54,873,799 (GRCm39) T452A probably benign Het
Cdh4 T C 2: 179,528,657 (GRCm39) probably null Het
Cfap61 A G 2: 145,987,378 (GRCm39) R1060G probably benign Het
Chd9 A G 8: 91,710,166 (GRCm39) D314G probably damaging Het
Cplx3 C T 9: 57,523,085 (GRCm39) V125I probably benign Het
Csmd1 T A 8: 15,950,710 (GRCm39) I3500F probably damaging Het
Dnah1 G T 14: 30,994,289 (GRCm39) Q2858K probably benign Het
Dnah6 C T 6: 73,053,583 (GRCm39) E2884K probably benign Het
Ecm1 G A 3: 95,643,275 (GRCm39) R342C probably damaging Het
Exosc10 T A 4: 148,652,840 (GRCm39) I485N probably benign Het
Fap T C 2: 62,384,201 (GRCm39) K2E probably damaging Het
Fzr1 C T 10: 81,206,201 (GRCm39) R162Q possibly damaging Het
Grap2 A T 15: 80,532,649 (GRCm39) Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 (GRCm39) W246R probably damaging Het
Kcna3 A T 3: 106,944,345 (GRCm39) I203F probably damaging Het
Kcng1 T C 2: 168,110,630 (GRCm39) E178G possibly damaging Het
Kif19a A C 11: 114,680,057 (GRCm39) H798P probably benign Het
Kif21b T C 1: 136,077,055 (GRCm39) L359P probably damaging Het
Krt6a A T 15: 101,600,792 (GRCm39) probably null Het
Lrp1 C T 10: 127,441,475 (GRCm39) S216N probably benign Het
Lrp3 A G 7: 34,901,790 (GRCm39) V676A probably benign Het
Lrrc63 T A 14: 75,363,332 (GRCm39) K266N possibly damaging Het
Mccc1 C T 3: 36,044,006 (GRCm39) V246M probably damaging Het
Mdn1 T C 4: 32,700,092 (GRCm39) V1395A possibly damaging Het
Mmrn1 A T 6: 60,921,755 (GRCm39) R71* probably null Het
Mrps2 C T 2: 28,359,500 (GRCm39) A119V probably benign Het
Ogdh T C 11: 6,299,384 (GRCm39) F750S probably damaging Het
Or1ak2 C A 2: 36,827,990 (GRCm39) N286K probably damaging Het
Or51aa2 T G 7: 103,188,274 (GRCm39) T56P probably benign Het
Or5p60 T A 7: 107,723,571 (GRCm39) I300F possibly damaging Het
Or8b3 A G 9: 38,314,232 (GRCm39) T18A probably damaging Het
Or8b42 A T 9: 38,341,707 (GRCm39) N43I probably damaging Het
Osbpl11 A C 16: 33,030,353 (GRCm39) I194L probably benign Het
Pacsin2 T C 15: 83,269,252 (GRCm39) E14G probably damaging Het
Pate7 T C 9: 35,687,952 (GRCm39) D96G probably damaging Het
Pcdh7 A G 5: 57,877,764 (GRCm39) T440A probably damaging Het
Pcdhb17 T C 18: 37,618,878 (GRCm39) S223P probably damaging Het
Pik3c2g G A 6: 139,693,904 (GRCm39) R109K probably benign Het
Ppp2ca T C 11: 51,989,916 (GRCm39) I14T possibly damaging Het
Rdh12 A T 12: 79,258,278 (GRCm39) T102S probably damaging Het
Rsf1 T A 7: 97,288,520 (GRCm39) C132* probably null Het
Rufy1 G A 11: 50,285,755 (GRCm39) L621F probably damaging Het
Ruvbl2 C T 7: 45,074,135 (GRCm39) R253H possibly damaging Het
Sdf2 A G 11: 78,145,819 (GRCm39) E172G probably damaging Het
Skint5 C T 4: 113,856,651 (GRCm39) probably null Het
Slc25a27 A G 17: 43,964,315 (GRCm39) I185T probably benign Het
Slc41a3 A C 6: 90,610,677 (GRCm39) K180Q probably benign Het
Slc7a14 A C 3: 31,291,598 (GRCm39) F227V probably damaging Het
Smg1 T C 7: 117,756,142 (GRCm39) probably benign Het
St6galnac1 A T 11: 116,656,689 (GRCm39) D483E probably damaging Het
Tes A G 6: 17,097,441 (GRCm39) K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 (GRCm39) D290Y probably damaging Het
Tifab T A 13: 56,324,164 (GRCm39) Y93F probably benign Het
Tmem131l A G 3: 83,848,196 (GRCm39) probably null Het
Tnfrsf21 T A 17: 43,396,265 (GRCm39) S516R probably benign Het
Ttn T C 2: 76,606,389 (GRCm39) Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 (GRCm39) S3692T probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Zfp113 T C 5: 138,149,459 (GRCm39) probably benign Het
Zfp26 T C 9: 20,348,921 (GRCm39) T548A probably benign Het
Zfp870 C T 17: 33,102,990 (GRCm39) G114D probably damaging Het
Other mutations in Fgfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fgfr1 APN 8 26,052,239 (GRCm39) nonsense probably null
IGL01537:Fgfr1 APN 8 26,045,595 (GRCm39) missense probably damaging 1.00
IGL01643:Fgfr1 APN 8 26,056,751 (GRCm39) missense probably benign 0.01
IGL01875:Fgfr1 APN 8 26,063,569 (GRCm39) missense possibly damaging 0.81
IGL02002:Fgfr1 APN 8 26,045,727 (GRCm39) missense probably damaging 1.00
IGL02698:Fgfr1 APN 8 26,063,624 (GRCm39) nonsense probably null
IGL02822:Fgfr1 APN 8 26,047,818 (GRCm39) missense probably benign 0.13
IGL03292:Fgfr1 APN 8 26,047,771 (GRCm39) missense possibly damaging 0.50
R0003:Fgfr1 UTSW 8 26,058,214 (GRCm39) missense possibly damaging 0.80
R0723:Fgfr1 UTSW 8 26,047,784 (GRCm39) missense probably damaging 0.99
R0730:Fgfr1 UTSW 8 26,045,760 (GRCm39) missense probably benign
R1144:Fgfr1 UTSW 8 26,048,159 (GRCm39) missense probably damaging 1.00
R1455:Fgfr1 UTSW 8 26,052,292 (GRCm39) missense possibly damaging 0.81
R1754:Fgfr1 UTSW 8 26,060,226 (GRCm39) missense probably damaging 1.00
R2045:Fgfr1 UTSW 8 26,048,231 (GRCm39) missense probably benign 0.04
R2139:Fgfr1 UTSW 8 26,060,882 (GRCm39) missense probably damaging 1.00
R2314:Fgfr1 UTSW 8 26,060,909 (GRCm39) missense probably damaging 1.00
R2517:Fgfr1 UTSW 8 26,053,462 (GRCm39) missense probably damaging 1.00
R2982:Fgfr1 UTSW 8 26,048,227 (GRCm39) missense probably benign 0.04
R3796:Fgfr1 UTSW 8 26,062,453 (GRCm39) missense probably damaging 1.00
R3797:Fgfr1 UTSW 8 26,062,453 (GRCm39) missense probably damaging 1.00
R3799:Fgfr1 UTSW 8 26,062,453 (GRCm39) missense probably damaging 1.00
R4323:Fgfr1 UTSW 8 26,063,915 (GRCm39) missense probably benign 0.37
R4594:Fgfr1 UTSW 8 26,063,852 (GRCm39) missense probably damaging 0.99
R4614:Fgfr1 UTSW 8 26,047,813 (GRCm39) missense probably benign 0.25
R4696:Fgfr1 UTSW 8 26,053,504 (GRCm39) missense probably damaging 0.99
R4916:Fgfr1 UTSW 8 26,053,542 (GRCm39) critical splice donor site probably null
R4966:Fgfr1 UTSW 8 26,062,461 (GRCm39) nonsense probably null
R5094:Fgfr1 UTSW 8 26,060,181 (GRCm39) missense probably damaging 1.00
R5730:Fgfr1 UTSW 8 26,063,827 (GRCm39) missense probably damaging 1.00
R5911:Fgfr1 UTSW 8 26,009,325 (GRCm39) utr 5 prime probably benign
R7310:Fgfr1 UTSW 8 26,052,331 (GRCm39) missense probably benign 0.01
R7326:Fgfr1 UTSW 8 26,063,855 (GRCm39) missense probably damaging 1.00
R7404:Fgfr1 UTSW 8 26,045,566 (GRCm39) missense probably benign
R7611:Fgfr1 UTSW 8 26,048,221 (GRCm39) nonsense probably null
R7681:Fgfr1 UTSW 8 26,045,677 (GRCm39) missense probably damaging 0.98
R7738:Fgfr1 UTSW 8 26,048,201 (GRCm39) missense probably damaging 0.96
R7789:Fgfr1 UTSW 8 26,052,329 (GRCm39) nonsense probably null
R7958:Fgfr1 UTSW 8 26,022,358 (GRCm39) missense probably benign
R8206:Fgfr1 UTSW 8 26,060,258 (GRCm39) missense probably damaging 1.00
R8236:Fgfr1 UTSW 8 26,052,288 (GRCm39) nonsense probably null
R8691:Fgfr1 UTSW 8 26,052,253 (GRCm39) missense possibly damaging 0.95
R9124:Fgfr1 UTSW 8 26,060,185 (GRCm39) missense probably damaging 1.00
R9633:Fgfr1 UTSW 8 26,060,776 (GRCm39) missense probably damaging 1.00
R9704:Fgfr1 UTSW 8 26,063,579 (GRCm39) missense probably benign 0.01
R9798:Fgfr1 UTSW 8 26,053,523 (GRCm39) missense unknown
Z1177:Fgfr1 UTSW 8 26,060,784 (GRCm39) missense possibly damaging 0.67
Z1177:Fgfr1 UTSW 8 26,053,414 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCAGACTTTGGCTTAGCTCG -3'
(R):5'- GCCCCAGTGATGGAATAAGATTCCC -3'

Sequencing Primer
(F):5'- AACCACCAACGTAAGTTTCTTG -3'
(R):5'- GGAATAAGATTCCCACCAGTTTAGC -3'
Posted On 2014-04-24