Incidental Mutation 'R1667:Nup93'
ID 187291
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
MMRRC Submission 039703-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # R1667 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 94214564-94317227 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94292687 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 47 (V47E)
Ref Sequence ENSEMBL: ENSMUSP00000148458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect possibly damaging
Transcript: ENSMUST00000079961
AA Change: V170E

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: V170E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109547
AA Change: V170E

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: V170E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211822
AA Change: V47E

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212062
Predicted Effect possibly damaging
Transcript: ENSMUST00000212824
AA Change: V170E

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212984
Meta Mutation Damage Score 0.0897 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,845,648 A26T possibly damaging Het
Adgrg3 T A 8: 95,033,373 Y73* probably null Het
Alk A T 17: 71,911,567 V761E probably damaging Het
Ankrd13a T C 5: 114,786,733 V93A possibly damaging Het
Anks1b T C 10: 90,511,184 probably null Het
Ascl1 T C 10: 87,492,793 N99S probably benign Het
Atm A T 9: 53,500,932 L972Q probably damaging Het
Atp2c1 A T 9: 105,432,797 L566Q probably null Het
Bank1 T A 3: 136,093,296 Y629F probably damaging Het
Bod1l G T 5: 41,816,775 L2399I probably benign Het
Bub1b G A 2: 118,641,189 G1010D probably benign Het
Ces1b G A 8: 93,056,904 H563Y possibly damaging Het
Cfap70 T C 14: 20,404,157 E853G probably benign Het
Cfh T C 1: 140,105,523 E779G probably benign Het
Cox7c A G 13: 86,045,884 S7P probably benign Het
Cyp2c67 A G 19: 39,643,590 probably null Het
Dhx30 G T 9: 110,085,445 L995I possibly damaging Het
Dhx30 G C 9: 110,085,446 N957K possibly damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Dstyk A G 1: 132,456,919 D717G probably damaging Het
Dusp10 A G 1: 184,036,858 D7G probably damaging Het
E230001N04Rik T G 17: 28,523,961 noncoding transcript Het
Ece2 T C 16: 20,637,838 S330P possibly damaging Het
Fam172a T A 13: 77,759,516 M1K probably null Het
Frmd5 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC 2: 121,548,730 probably null Het
Gata3 T C 2: 9,877,549 H14R possibly damaging Het
Ggta1 T A 2: 35,414,283 I75F possibly damaging Het
Hcn1 A T 13: 117,603,073 I124F unknown Het
Herpud1 A C 8: 94,389,366 D53A probably damaging Het
Inhba T A 13: 16,026,624 L257Q possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Jmy T A 13: 93,498,370 S313C probably damaging Het
Lpo G A 11: 87,807,241 probably benign Het
Lsg1 T C 16: 30,571,352 E315G probably damaging Het
Lsm14a T A 7: 34,365,654 T167S possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k2 T C 18: 32,203,792 probably benign Het
Mapk12 A T 15: 89,140,141 M81K probably damaging Het
Matn2 T A 15: 34,378,732 C305S probably damaging Het
Mgam T C 6: 40,677,044 Y844H possibly damaging Het
Mgat5b A G 11: 116,947,377 R281G probably benign Het
Mon1b T G 8: 113,641,957 C497G probably damaging Het
Mybbp1a A T 11: 72,445,217 H452L probably benign Het
Mybl2 A G 2: 163,075,696 T41A probably damaging Het
Ncoa5 A G 2: 165,001,703 V540A probably damaging Het
Olfr1052 A G 2: 86,298,736 M307V probably null Het
Olfr17 A T 7: 107,097,770 M102L probably benign Het
Orc6 T A 8: 85,305,285 C100S possibly damaging Het
Otogl G T 10: 107,813,965 Y1176* probably null Het
Patj A T 4: 98,413,027 D183V probably damaging Het
Pik3r3 A G 4: 116,222,317 T4A probably damaging Het
Pla2g4d G A 2: 120,270,150 probably benign Het
Pla2r1 A G 2: 60,420,257 I1407T probably benign Het
Pramef12 A T 4: 144,393,036 C320* probably null Het
Prex2 A T 1: 11,186,757 H1231L probably benign Het
Prkca A G 11: 107,983,946 V390A probably damaging Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rec8 T A 14: 55,618,796 N37K probably damaging Het
Rnf207 C T 4: 152,313,215 E361K probably benign Het
Serpina3f T A 12: 104,217,440 L187Q probably damaging Het
Skint11 A T 4: 114,194,781 T109S probably damaging Het
Slc7a8 A G 14: 54,724,849 S443P probably damaging Het
Slc8b1 T A 5: 120,521,082 F197Y probably benign Het
Sox2 T C 3: 34,650,419 Y2H probably damaging Het
Speg T A 1: 75,410,549 probably benign Het
Tlr3 T C 8: 45,400,837 N149D probably benign Het
Trim60 A C 8: 65,001,464 D44E probably benign Het
Ugt1a7c A G 1: 88,095,935 Y272C probably damaging Het
Vmn1r4 T A 6: 56,956,753 Y81N probably damaging Het
Vmn2r73 A T 7: 85,857,681 C808S probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp672 T C 11: 58,316,095 T467A possibly damaging Het
Zfp985 A T 4: 147,583,950 Q425L possibly damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 94309023 critical splice donor site probably null
IGL01652:Nup93 APN 8 94296559 missense possibly damaging 0.93
IGL02003:Nup93 APN 8 94302109 nonsense probably null
IGL02169:Nup93 APN 8 94302129 missense probably damaging 1.00
IGL02212:Nup93 APN 8 94311662 critical splice donor site probably null
IGL02551:Nup93 APN 8 94227833 nonsense probably null
IGL02568:Nup93 APN 8 94309635 missense probably damaging 1.00
IGL03094:Nup93 APN 8 94296502 missense probably benign
IGL03248:Nup93 APN 8 94306088 missense probably damaging 0.98
IGL03273:Nup93 APN 8 94306277 missense probably benign 0.01
IGL03401:Nup93 APN 8 94309711 splice site probably null
PIT4585001:Nup93 UTSW 8 94243727 missense probably benign 0.25
R0409:Nup93 UTSW 8 94303665 missense probably damaging 1.00
R0748:Nup93 UTSW 8 94307943 missense probably damaging 1.00
R0891:Nup93 UTSW 8 94281263 splice site probably benign
R1696:Nup93 UTSW 8 94296555 missense probably benign 0.29
R1862:Nup93 UTSW 8 94306102 missense probably damaging 1.00
R2069:Nup93 UTSW 8 94243739 missense probably damaging 1.00
R2143:Nup93 UTSW 8 94296480 nonsense probably null
R2187:Nup93 UTSW 8 94300850 missense probably damaging 1.00
R2228:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2229:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2254:Nup93 UTSW 8 94227857 critical splice donor site probably null
R2884:Nup93 UTSW 8 94303638 missense probably damaging 1.00
R4521:Nup93 UTSW 8 94314636 missense probably damaging 1.00
R4563:Nup93 UTSW 8 94307892 missense probably damaging 1.00
R4900:Nup93 UTSW 8 94286603 missense probably benign 0.25
R5570:Nup93 UTSW 8 94314670 missense probably damaging 1.00
R6226:Nup93 UTSW 8 94286537 missense probably damaging 1.00
R6489:Nup93 UTSW 8 94302088 missense probably benign 0.10
R6658:Nup93 UTSW 8 94304179 missense probably benign 0.02
R6817:Nup93 UTSW 8 94314682 critical splice donor site probably null
R6895:Nup93 UTSW 8 94243686 missense probably damaging 1.00
R6955:Nup93 UTSW 8 94309673 missense probably damaging 0.96
R7476:Nup93 UTSW 8 94303632 missense probably damaging 1.00
R7643:Nup93 UTSW 8 94286619 critical splice donor site probably null
R7994:Nup93 UTSW 8 94306302 missense probably benign 0.15
R8461:Nup93 UTSW 8 94281335 critical splice donor site probably null
R9177:Nup93 UTSW 8 94227743 missense probably benign 0.25
R9264:Nup93 UTSW 8 94292720 missense probably benign 0.01
R9532:Nup93 UTSW 8 94314621 missense probably damaging 1.00
R9567:Nup93 UTSW 8 94308976 missense possibly damaging 0.94
R9629:Nup93 UTSW 8 94306639 missense probably damaging 0.99
R9721:Nup93 UTSW 8 94303685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCTGTTAGAGGATAGCTGAAC -3'
(R):5'- AGAGCAAATTTCAATTTCCCCGCAC -3'

Sequencing Primer
(F):5'- AACCTGTGTCCTTGTAGCAGAG -3'
(R):5'- CCGCACTATCTGAGTCATGAG -3'
Posted On 2014-05-09