Incidental Mutation 'R1406:Asb8'
ID188750
Institutional Source Beutler Lab
Gene Symbol Asb8
Ensembl Gene ENSMUSG00000048175
Gene Nameankyrin repeat and SOCS box-containing 8
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98134637-98165625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98136423 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 84 (G84C)
Ref Sequence ENSEMBL: ENSMUSP00000115813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051226] [ENSMUST00000059112] [ENSMUST00000123626] [ENSMUST00000123922] [ENSMUST00000143400] [ENSMUST00000163507] [ENSMUST00000230445]
Predicted Effect probably benign
Transcript: ENSMUST00000051226
SMART Domains Protein: ENSMUSP00000059801
Gene: ENSMUSG00000033065

DomainStartEndE-ValueType
Pfam:PFK 17 324 1.3e-111 PFAM
Pfam:PFK 402 687 1e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059112
AA Change: G84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057864
Gene: ENSMUSG00000048175
AA Change: G84C

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123626
AA Change: G84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121383
Gene: ENSMUSG00000048175
AA Change: G84C

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123922
AA Change: G84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119481
Gene: ENSMUSG00000048175
AA Change: G84C

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143400
AA Change: G84C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115813
Gene: ENSMUSG00000048175
AA Change: G84C

DomainStartEndE-ValueType
Blast:ANK 20 49 5e-13 BLAST
ANK 52 81 4.5e-3 SMART
ANK 85 113 1.22e-4 SMART
ANK 117 146 1.81e-7 SMART
ANK 150 179 2.45e-4 SMART
SOCS_box 247 287 2.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163507
SMART Domains Protein: ENSMUSP00000132803
Gene: ENSMUSG00000033065

DomainStartEndE-ValueType
Pfam:PFK 16 326 2.9e-138 PFAM
Pfam:PFK 401 688 1.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230445
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Asb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Asb8 APN 15 98141278 splice site probably benign
IGL01367:Asb8 APN 15 98136173 missense probably damaging 1.00
IGL01375:Asb8 APN 15 98141309 missense probably damaging 0.98
IGL03007:Asb8 APN 15 98142734 missense probably damaging 0.99
IGL03192:Asb8 APN 15 98135895 missense possibly damaging 0.87
R0025:Asb8 UTSW 15 98142671 missense possibly damaging 0.84
R1405:Asb8 UTSW 15 98141367 missense possibly damaging 0.85
R1405:Asb8 UTSW 15 98141367 missense possibly damaging 0.85
R1406:Asb8 UTSW 15 98136423 missense probably damaging 1.00
R1570:Asb8 UTSW 15 98136428 missense probably damaging 0.99
R1958:Asb8 UTSW 15 98136216 missense possibly damaging 0.88
R2049:Asb8 UTSW 15 98136069 nonsense probably null
R2060:Asb8 UTSW 15 98141373 missense possibly damaging 0.93
R4448:Asb8 UTSW 15 98141330 missense possibly damaging 0.92
R5835:Asb8 UTSW 15 98136382 missense probably damaging 0.98
R6092:Asb8 UTSW 15 98136242 missense possibly damaging 0.94
R6718:Asb8 UTSW 15 98136134 missense probably benign 0.03
R7052:Asb8 UTSW 15 98136401 missense probably damaging 0.98
R7901:Asb8 UTSW 15 98142733 missense probably damaging 1.00
R7984:Asb8 UTSW 15 98142733 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAATCCAGGGCATTGACGGAGG -3'
(R):5'- CTCAGCAGTAGTGCAGACTTGGAC -3'

Sequencing Primer
(F):5'- GCATTGTTCTTAAAGGCTGCCC -3'
(R):5'- AGTGCAGACTTGGACTTCATC -3'
Posted On2014-05-09