Incidental Mutation 'R1406:Fnip2'
ID188732
Institutional Source Beutler Lab
Gene Symbol Fnip2
Ensembl Gene ENSMUSG00000061175
Gene Namefolliculin interacting protein 2
SynonymsD630023B12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location79455974-79567796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79508091 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 213 (N213K)
Ref Sequence ENSEMBL: ENSMUSP00000075497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076136
AA Change: N213K

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: N213K

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130613
Predicted Effect possibly damaging
Transcript: ENSMUST00000133154
AA Change: N213K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: N213K

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139171
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Fnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Fnip2 APN 3 79481521 missense probably benign
IGL00339:Fnip2 APN 3 79515155 missense probably benign 0.12
IGL00340:Fnip2 APN 3 79518061 splice site probably benign
IGL00434:Fnip2 APN 3 79512489 splice site probably benign
IGL01134:Fnip2 APN 3 79512503 nonsense probably null
IGL02732:Fnip2 APN 3 79465697 missense probably damaging 1.00
IGL03327:Fnip2 APN 3 79518081 missense probably damaging 0.98
IGL03402:Fnip2 APN 3 79481276 missense possibly damaging 0.92
R0314:Fnip2 UTSW 3 79481189 missense probably damaging 1.00
R0318:Fnip2 UTSW 3 79512378 missense probably damaging 1.00
R0699:Fnip2 UTSW 3 79481139 missense probably benign 0.00
R1188:Fnip2 UTSW 3 79462162 missense probably damaging 1.00
R1290:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1535:Fnip2 UTSW 3 79481765 missense probably damaging 1.00
R1618:Fnip2 UTSW 3 79508168 missense possibly damaging 0.70
R1661:Fnip2 UTSW 3 79515149 missense probably benign
R1665:Fnip2 UTSW 3 79515149 missense probably benign
R1965:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1966:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1976:Fnip2 UTSW 3 79480931 missense probably benign 0.02
R2004:Fnip2 UTSW 3 79512325 splice site probably benign
R2054:Fnip2 UTSW 3 79572465 unclassified probably benign
R2145:Fnip2 UTSW 3 79500432 missense probably damaging 0.99
R2400:Fnip2 UTSW 3 79479634 missense probably benign 0.03
R2679:Fnip2 UTSW 3 79480926 missense probably benign 0.13
R3157:Fnip2 UTSW 3 79567594 missense probably damaging 1.00
R3851:Fnip2 UTSW 3 79462157 missense probably damaging 1.00
R3910:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3911:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3912:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R4035:Fnip2 UTSW 3 79479501 missense probably benign 0.00
R4166:Fnip2 UTSW 3 79462135 missense probably damaging 1.00
R4537:Fnip2 UTSW 3 79465714 missense probably damaging 0.98
R4732:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4733:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4774:Fnip2 UTSW 3 79465721 nonsense probably null
R4923:Fnip2 UTSW 3 79489394 critical splice acceptor site probably null
R5043:Fnip2 UTSW 3 79492867 nonsense probably null
R5160:Fnip2 UTSW 3 79488991 missense probably damaging 1.00
R5162:Fnip2 UTSW 3 79481777 missense probably damaging 1.00
R5196:Fnip2 UTSW 3 79572538 unclassified probably benign
R5283:Fnip2 UTSW 3 79465708 missense probably damaging 1.00
R5364:Fnip2 UTSW 3 79481168 missense probably benign 0.00
R5402:Fnip2 UTSW 3 79480943 missense possibly damaging 0.89
R6340:Fnip2 UTSW 3 79507845 missense probably damaging 1.00
R6459:Fnip2 UTSW 3 79481634 missense possibly damaging 0.93
R6592:Fnip2 UTSW 3 79481708 missense probably benign 0.26
R6616:Fnip2 UTSW 3 79480882 missense probably benign 0.00
R6933:Fnip2 UTSW 3 79518111 missense probably benign 0.28
R6962:Fnip2 UTSW 3 79489303 missense probably damaging 1.00
R6971:Fnip2 UTSW 3 79481121 nonsense probably null
R7050:Fnip2 UTSW 3 79506270 missense probably damaging 0.99
R7097:Fnip2 UTSW 3 79481006 missense probably benign
R7315:Fnip2 UTSW 3 79506205 critical splice donor site probably null
R7714:Fnip2 UTSW 3 79518114 missense probably damaging 1.00
R7782:Fnip2 UTSW 3 79508123 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCCTCCTTCAGACAACCCCTG -3'
(R):5'- CCGGTGTCTCATTTCAGACCCTCAG -3'

Sequencing Primer
(F):5'- AGTTTGCCGCTGCACAC -3'
(R):5'- AGATCCTCAGGCTGGAAAAC -3'
Posted On2014-05-09