Incidental Mutation 'R1406:Armc8'
ID188741
Institutional Source Beutler Lab
Gene Symbol Armc8
Ensembl Gene ENSMUSG00000032468
Gene Namearmadillo repeat containing 8
Synonyms1200015K23Rik, HSPC056, Gid5
Accession Numbers

Genbank: NM_028768; MGI: 1921375

Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99478372-99568899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 99523248 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 268 (P268Q)
Ref Sequence ENSEMBL: ENSMUSP00000140426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035043] [ENSMUST00000185524] [ENSMUST00000186049]
Predicted Effect probably benign
Transcript: ENSMUST00000035043
AA Change: P310Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468
AA Change: P310Q

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
ARM 177 217 2.04e1 SMART
ARM 372 413 3.58e1 SMART
Blast:ARM 414 455 7e-17 BLAST
ARM 457 497 3.81e-1 SMART
ARM 500 540 5.43e1 SMART
Blast:ARM 542 585 1e-20 BLAST
Blast:ARM 633 673 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185524
AA Change: P310Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139973
Gene: ENSMUSG00000032468
AA Change: P310Q

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
Blast:ARM 138 176 1e-5 BLAST
ARM 177 217 2.04e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186049
AA Change: P268Q

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140426
Gene: ENSMUSG00000032468
AA Change: P268Q

DomainStartEndE-ValueType
ARM 8 50 8.5e-3 SMART
ARM 52 92 2.6e-2 SMART
Blast:ARM 96 134 7e-6 BLAST
ARM 135 175 9.8e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Armc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Armc8 APN 9 99505734 critical splice acceptor site probably null
IGL00951:Armc8 APN 9 99505704 missense probably benign 0.00
IGL01776:Armc8 APN 9 99526883 splice site probably benign
IGL02215:Armc8 APN 9 99483978 missense possibly damaging 0.92
IGL02244:Armc8 APN 9 99483174 missense probably benign 0.10
IGL02610:Armc8 APN 9 99527069 splice site probably benign
IGL02612:Armc8 APN 9 99527069 splice site probably benign
IGL02615:Armc8 APN 9 99527069 splice site probably benign
IGL02619:Armc8 APN 9 99527069 splice site probably benign
IGL02621:Armc8 APN 9 99527069 splice site probably benign
IGL02622:Armc8 APN 9 99527069 splice site probably benign
IGL02623:Armc8 APN 9 99527069 splice site probably benign
IGL02624:Armc8 APN 9 99527069 splice site probably benign
D4043:Armc8 UTSW 9 99483976 missense probably benign 0.13
R0321:Armc8 UTSW 9 99533177 missense probably damaging 0.99
R0498:Armc8 UTSW 9 99497292 missense probably damaging 1.00
R0646:Armc8 UTSW 9 99505688 missense probably damaging 1.00
R0658:Armc8 UTSW 9 99536158 splice site probably benign
R1061:Armc8 UTSW 9 99537731 missense probably damaging 1.00
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1429:Armc8 UTSW 9 99536207 missense possibly damaging 0.67
R1432:Armc8 UTSW 9 99523132 splice site probably benign
R1538:Armc8 UTSW 9 99505290 missense probably damaging 0.96
R1606:Armc8 UTSW 9 99537729 missense probably damaging 0.98
R1817:Armc8 UTSW 9 99536259 missense possibly damaging 0.67
R1866:Armc8 UTSW 9 99536280 missense probably benign
R2015:Armc8 UTSW 9 99483105 nonsense probably null
R2143:Armc8 UTSW 9 99505308 missense probably damaging 0.99
R2251:Armc8 UTSW 9 99502600 critical splice acceptor site probably null
R2842:Armc8 UTSW 9 99505681 missense probably benign
R3010:Armc8 UTSW 9 99487913 missense probably benign 0.06
R3709:Armc8 UTSW 9 99520497 missense probably damaging 1.00
R4440:Armc8 UTSW 9 99484034 missense probably benign 0.37
R4865:Armc8 UTSW 9 99526889 critical splice donor site probably null
R5492:Armc8 UTSW 9 99527131 nonsense probably null
R5606:Armc8 UTSW 9 99536262 missense probably benign 0.23
R5639:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5693:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5694:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5698:Armc8 UTSW 9 99535820 missense probably benign 0.12
R5700:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5701:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5735:Armc8 UTSW 9 99497394 critical splice acceptor site probably null
R6314:Armc8 UTSW 9 99535884 missense probably benign 0.28
R7034:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7036:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7393:Armc8 UTSW 9 99483999 missense possibly damaging 0.47
R7395:Armc8 UTSW 9 99533132 missense probably damaging 0.99
R8130:Armc8 UTSW 9 99551547 missense probably benign 0.02
Z1177:Armc8 UTSW 9 99497386 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCTCTCAGATGGAATTGTCAATTGT -3'
(R):5'- TGCTGATTAAACAGCCAGTTCTCACAT -3'

Sequencing Primer
(F):5'- GTTTCAAAGCTGTGTGCAATAAG -3'
(R):5'- TGTCAGGAGTTCTCAAATGCC -3'
Posted On2014-05-09