Incidental Mutation 'R1406:Rtn4'
ID188745
Institutional Source Beutler Lab
Gene Symbol Rtn4
Ensembl Gene ENSMUSG00000020458
Gene Namereticulon 4
SynonymsNOGO, C130026I10Rik, NgA, 1110020G17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29692947-29744331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29708236 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 797 (T797A)
Ref Sequence ENSEMBL: ENSMUSP00000099907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078830] [ENSMUST00000102841] [ENSMUST00000102842] [ENSMUST00000102843] [ENSMUST00000170731]
Predicted Effect probably benign
Transcript: ENSMUST00000078830
SMART Domains Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102841
AA Change: T681A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099905
Gene: ENSMUSG00000020458
AA Change: T681A

DomainStartEndE-ValueType
low complexity region 102 110 N/A INTRINSIC
Pfam:Reticulon 859 1029 6.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102842
SMART Domains Protein: ENSMUSP00000099906
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 188 358 4.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102843
AA Change: T797A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099907
Gene: ENSMUSG00000020458
AA Change: T797A

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
low complexity region 218 226 N/A INTRINSIC
Pfam:Reticulon 975 1139 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170731
SMART Domains Protein: ENSMUSP00000126413
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the A and B isoforms are viable and one line shows enhanced regeneration and recovery after spinal cord injury. Different lines of mice lacking isoforms A, B, and C show varying phenotypes. Whereas some produce viable homozygotes, others are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Rtn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Rtn4 APN 11 29707291 missense probably damaging 1.00
IGL02187:Rtn4 APN 11 29708291 missense possibly damaging 0.78
IGL02475:Rtn4 APN 11 29733801 missense probably damaging 1.00
IGL02751:Rtn4 APN 11 29706409 critical splice acceptor site probably null
R0063:Rtn4 UTSW 11 29705527 intron probably benign
R0110:Rtn4 UTSW 11 29733849 splice site probably benign
R0510:Rtn4 UTSW 11 29733849 splice site probably benign
R0653:Rtn4 UTSW 11 29707256 missense probably damaging 1.00
R0658:Rtn4 UTSW 11 29706475 missense probably damaging 1.00
R1353:Rtn4 UTSW 11 29707595 missense probably damaging 1.00
R1384:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1873:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1960:Rtn4 UTSW 11 29736464 missense probably damaging 1.00
R1980:Rtn4 UTSW 11 29708634 missense probably benign 0.00
R2319:Rtn4 UTSW 11 29707154 missense probably benign 0.06
R2888:Rtn4 UTSW 11 29693687 missense probably damaging 0.98
R3150:Rtn4 UTSW 11 29693308 small deletion probably benign
R3403:Rtn4 UTSW 11 29707690 missense probably benign 0.12
R3974:Rtn4 UTSW 11 29707505 missense probably damaging 1.00
R3977:Rtn4 UTSW 11 29693819 missense probably benign 0.01
R4223:Rtn4 UTSW 11 29706856 missense probably benign 0.02
R4725:Rtn4 UTSW 11 29708362 missense probably damaging 1.00
R4801:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4802:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4974:Rtn4 UTSW 11 29740994 missense probably damaging 1.00
R4983:Rtn4 UTSW 11 29707217 missense probably benign 0.43
R5292:Rtn4 UTSW 11 29707924 missense probably benign 0.39
R5332:Rtn4 UTSW 11 29733645 missense probably damaging 1.00
R5551:Rtn4 UTSW 11 29741011 missense probably damaging 1.00
R5604:Rtn4 UTSW 11 29708140 missense probably damaging 0.97
R6046:Rtn4 UTSW 11 29708023 missense probably damaging 1.00
R6928:Rtn4 UTSW 11 29706791 missense possibly damaging 0.92
R7386:Rtn4 UTSW 11 29707772 missense probably damaging 1.00
R7743:Rtn4 UTSW 11 29733790 nonsense probably null
R7784:Rtn4 UTSW 11 29741048 nonsense probably null
R7832:Rtn4 UTSW 11 29741048 nonsense probably null
R7846:Rtn4 UTSW 11 29693274 missense unknown
R7896:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
R7915:Rtn4 UTSW 11 29741048 nonsense probably null
R7929:Rtn4 UTSW 11 29693274 missense unknown
R7979:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
RF006:Rtn4 UTSW 11 29706919 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GATTCCTCACCCGAATCTGAACCAG -3'
(R):5'- GGGCAATTCTGAGCAAGGCAAC -3'

Sequencing Primer
(F):5'- GTGATGATTCAATTCCTGAAGTCCC -3'
(R):5'- GGAGAATCATCTTTAGCACTGAC -3'
Posted On2014-05-09