Incidental Mutation 'R1693:Ggt7'
ID191914
Institutional Source Beutler Lab
Gene Symbol Ggt7
Ensembl Gene ENSMUSG00000027603
Gene Namegamma-glutamyltransferase 7
Synonyms1110017C11Rik, 6330563L03Rik, Ggtl3
MMRRC Submission 039726-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155490379-155518237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155506475 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 10 (R10W)
Ref Sequence ENSEMBL: ENSMUSP00000135314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029131] [ENSMUST00000147601] [ENSMUST00000176117]
Predicted Effect probably damaging
Transcript: ENSMUST00000029131
AA Change: R86W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029131
Gene: ENSMUSG00000027603
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 655 1.4e-143 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147601
AA Change: R86W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120560
Gene: ENSMUSG00000027603
AA Change: R86W

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 202 6.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148296
Predicted Effect probably damaging
Transcript: ENSMUST00000176117
AA Change: R10W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135314
Gene: ENSMUSG00000027603
AA Change: R10W

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:G_glu_transpept 78 271 1.4e-63 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a gene family that encodes enzymes involved in both the metabolism of glutathione and in the transpeptidation of amino acids. Changes in the activity of gamma-glutamyltransferase may signal preneoplastic or toxic conditions in the liver or kidney. The protein encoded by this gene consists of a heavy and a light chain, and it can interact with CT120, a plasma membrane-associated protein that is possibly involved in lung carcinogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
Creb3 C A 4: 43,566,755 H390Q probably damaging Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Ggt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ggt7 APN 2 155500771 missense probably damaging 0.99
IGL02523:Ggt7 APN 2 155514703 missense probably damaging 1.00
IGL02999:Ggt7 APN 2 155502713 missense probably benign 0.00
R0030:Ggt7 UTSW 2 155506488 missense probably benign 0.00
R0038:Ggt7 UTSW 2 155502781 missense probably benign 0.08
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0106:Ggt7 UTSW 2 155494893 missense possibly damaging 0.63
R0683:Ggt7 UTSW 2 155506508 missense probably benign 0.08
R1035:Ggt7 UTSW 2 155506427 missense probably damaging 1.00
R1500:Ggt7 UTSW 2 155499046 missense probably benign 0.00
R1633:Ggt7 UTSW 2 155502688 missense probably damaging 1.00
R1696:Ggt7 UTSW 2 155494979 missense possibly damaging 0.89
R1879:Ggt7 UTSW 2 155514787 missense possibly damaging 0.91
R2219:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R2220:Ggt7 UTSW 2 155495719 missense probably damaging 1.00
R4010:Ggt7 UTSW 2 155500732 missense probably benign 0.00
R5602:Ggt7 UTSW 2 155490999 missense possibly damaging 0.82
R5680:Ggt7 UTSW 2 155506433 missense probably damaging 1.00
R6092:Ggt7 UTSW 2 155518039 critical splice donor site probably null
R6440:Ggt7 UTSW 2 155498811 missense probably damaging 1.00
R6989:Ggt7 UTSW 2 155503460 missense probably benign 0.25
R7050:Ggt7 UTSW 2 155506375 missense probably benign 0.10
R7058:Ggt7 UTSW 2 155503095 splice site probably null
R7395:Ggt7 UTSW 2 155495880 missense probably benign 0.26
R7768:Ggt7 UTSW 2 155506501 missense possibly damaging 0.60
R7946:Ggt7 UTSW 2 155505972 missense probably damaging 0.98
X0065:Ggt7 UTSW 2 155495695 missense probably benign 0.37
Z1176:Ggt7 UTSW 2 155491078 missense probably damaging 0.99
Z1176:Ggt7 UTSW 2 155499063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCACCCTGCTGGAAGATCTAAG -3'
(R):5'- TATTCTCAGCCTGGAGAGCCAGAC -3'

Sequencing Primer
(F):5'- CTGCTGGAAGATCTAAGAGCAAG -3'
(R):5'- TATTTGCCAGAGGCAGAAATCC -3'
Posted On2014-05-14