Incidental Mutation 'R1693:Creb3'
ID191920
Institutional Source Beutler Lab
Gene Symbol Creb3
Ensembl Gene ENSMUSG00000028466
Gene NamecAMP responsive element binding protein 3
SynonymsLZIP, LZIP-1, Luman, LZIP-2
MMRRC Submission 039726-MU
Accession Numbers

NCBI RefSeq: NM_013497.3; MGI: 99946

Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R1693 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43562332-43567060 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43566755 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 390 (H390Q)
Ref Sequence ENSEMBL: ENSMUSP00000129401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably benign
Transcript: ENSMUST00000030187
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030189
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102944
AA Change: H366Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466
AA Change: H366Q

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130670
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect probably damaging
Transcript: ENSMUST00000167751
AA Change: H390Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466
AA Change: H390Q

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff4 A G 11: 53,396,553 D378G probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Aox1 T C 1: 58,085,542 Y981H probably damaging Het
Arfgap2 T A 2: 91,270,075 probably null Het
Ccnf TGGGGG TGGGGGGG 17: 24,226,540 probably null Het
Cd53 T C 3: 106,768,889 N54S possibly damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd7 T C 4: 8,864,307 probably null Het
Chrm5 A G 2: 112,479,280 L497P probably damaging Het
Colec12 G A 18: 9,866,765 V659M unknown Het
D1Pas1 T C 1: 186,968,029 F52L probably benign Het
D5Ertd579e A G 5: 36,614,097 F985L probably damaging Het
Dock4 C T 12: 40,834,722 P1742S probably benign Het
Ehmt2 G T 17: 34,906,410 V534L possibly damaging Het
Epcam A G 17: 87,639,896 D26G probably benign Het
F2 C T 2: 91,629,179 V420M probably damaging Het
Fbxw16 A T 9: 109,436,259 D401E possibly damaging Het
Fiz1 T C 7: 5,008,728 T264A probably benign Het
Fsbp T C 4: 11,583,745 V148A probably benign Het
Furin A G 7: 80,392,482 L455P probably damaging Het
Ggt7 G A 2: 155,506,475 R10W probably damaging Het
Gucy2g T C 19: 55,222,926 E624G probably damaging Het
Igf2r A G 17: 12,704,316 F1202S probably damaging Het
Ikzf1 C T 11: 11,707,838 P32S probably damaging Het
Itgal G A 7: 127,305,281 V309M probably damaging Het
Kcnk5 C A 14: 20,141,896 R399L probably damaging Het
Kdm5b C T 1: 134,597,576 probably benign Het
Lrp2 C T 2: 69,510,418 V1038M probably damaging Het
Lrp4 T C 2: 91,492,353 Y1096H probably damaging Het
Lrrc7 C G 3: 158,084,533 S1465T possibly damaging Het
Maats1 A G 16: 38,341,723 Y19H probably benign Het
Map3k5 A G 10: 20,104,242 N832S probably damaging Het
Mkl2 C A 16: 13,398,470 L349I possibly damaging Het
Mkl2 T A 16: 13,398,471 L349Q probably damaging Het
Myh13 A C 11: 67,341,484 M495L possibly damaging Het
Myh9 A C 15: 77,812,897 Y106D probably damaging Het
Naa16 A T 14: 79,351,456 W452R probably damaging Het
Nsd1 T C 13: 55,247,261 S892P probably benign Het
Nup205 A G 6: 35,210,971 I939V probably benign Het
Oit3 A G 10: 59,425,417 F476S probably damaging Het
Olfr868 T C 9: 20,101,587 V276A probably benign Het
Panx3 A T 9: 37,668,907 M50K possibly damaging Het
Panx3 A C 9: 37,668,946 M37R possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prkaca T A 8: 83,981,198 D37E probably benign Het
Prkcq T A 2: 11,254,199 I310N probably damaging Het
Prrc2c A G 1: 162,718,713 Y235H probably damaging Het
Ptprj A T 2: 90,449,797 C1052* probably null Het
Rad52 C A 6: 119,916,035 P180Q probably damaging Het
Sdhaf3 T A 6: 7,038,964 D95E probably benign Het
Slitrk6 A G 14: 110,750,928 I449T probably damaging Het
Spata7 T A 12: 98,664,257 M358K possibly damaging Het
Tada2a C T 11: 84,082,069 G178D probably damaging Het
Tap2 G C 17: 34,209,212 V287L probably benign Het
Tmem200a A G 10: 25,993,979 F131L possibly damaging Het
Tmem55a T A 4: 14,886,631 D68E probably benign Het
Traip A T 9: 107,970,030 K356M probably damaging Het
Tspan8 T A 10: 115,844,044 probably benign Het
U2surp A T 9: 95,511,860 M1K probably null Het
Vars A T 17: 34,998,196 D427E probably benign Het
Vmn1r113 G A 7: 20,787,607 C108Y probably damaging Het
Vmn2r63 T A 7: 42,928,319 Q265L probably benign Het
Vps33b T A 7: 80,287,893 V463E probably damaging Het
Vrtn T C 12: 84,648,655 S60P probably benign Het
Zfp53 T A 17: 21,509,622 V639D possibly damaging Het
Zfp964 T A 8: 69,664,150 S466T possibly damaging Het
Other mutations in Creb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Creb3 APN 4 43565517 missense probably benign
IGL02641:Creb3 APN 4 43563311 missense probably benign 0.00
IGL03101:Creb3 APN 4 43563081 missense probably benign 0.11
IGL03163:Creb3 APN 4 43566315 missense probably damaging 1.00
P0014:Creb3 UTSW 4 43563265 missense possibly damaging 0.53
PIT4362001:Creb3 UTSW 4 43565472 nonsense probably null
R0959:Creb3 UTSW 4 43563509 missense probably damaging 1.00
R1506:Creb3 UTSW 4 43566193 missense possibly damaging 0.95
R1624:Creb3 UTSW 4 43566375 missense possibly damaging 0.67
R1794:Creb3 UTSW 4 43563302 missense probably benign 0.06
R1956:Creb3 UTSW 4 43563279 critical splice acceptor site probably null
R1991:Creb3 UTSW 4 43565327 missense probably damaging 1.00
R2179:Creb3 UTSW 4 43566306 missense probably damaging 1.00
R3811:Creb3 UTSW 4 43565501 nonsense probably null
R4673:Creb3 UTSW 4 43563192 missense probably benign 0.20
R4713:Creb3 UTSW 4 43563247 missense probably benign 0.00
R5613:Creb3 UTSW 4 43566196 missense probably benign 0.41
R6195:Creb3 UTSW 4 43566346 missense probably benign 0.23
R7673:Creb3 UTSW 4 43563117 missense not run
R7829:Creb3 UTSW 4 43566322 missense probably damaging 1.00
R7872:Creb3 UTSW 4 43563332 missense probably benign 0.04
R8726:Creb3 UTSW 4 43566747 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCAGCCGAAGCCATCTGCTCTATC -3'
(R):5'- TCTCCAAATCTATTCACGGGGCAAC -3'

Sequencing Primer
(F):5'- AAGCCATCTGCTCTATCGTCAG -3'
(R):5'- TCTATTCACGGGGCAACAGATAC -3'
Posted On2014-05-14