Mutagenetix > Incidental Mutations

Incidental Mutation 'R1760:Clpb'

192697

Institutional Source

Beutler Lab

Gene Symbol

Clpb

Ensembl Gene

ENSMUSG00000001829

Gene Name

ClpB caseinolytic peptidase B

Synonyms

Skd3

MMRRC Submission

039792-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R1760 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101663633-101795506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101786698 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 578 (V578E)

Ref Sequence

ENSEMBL: ENSMUSP00000148062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000209579]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001884
AA Change: V578E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: V578E

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	235	264	6.65e-6	SMART
low complexity region	294	306	N/A	INTRINSIC
AAA	343	497	6.36e-10	SMART
ClpB_D2-small	541	630	6.83e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106998
AA Change: V608E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: V608E

Domain	Start	End	E-Value	Type
ANK	133	162	2.03e-1	SMART
ANK	166	195	1.96e-3	SMART
ANK	265	294	6.65e-6	SMART
low complexity region	324	336	N/A	INTRINSIC
AAA	373	527	6.36e-10	SMART
ClpB_D2-small	571	660	6.83e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150355

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150832

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209579
AA Change: V578E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210465

Meta Mutation Damage Score

0.8095

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.6%

Validation Efficiency

97% (95/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	A	4: 41,507,330		probably null	Het
2310035C23Rik	T	G	1: 105,719,444		probably benign	Het
Abca2	T	C	2: 25,443,043	S1585P	probably benign	Het
Abhd16b	T	C	2: 181,493,404	F33S	probably damaging	Het
Adgra2	G	A	8: 27,119,767	R856Q	probably damaging	Het
Aff3	A	T	1: 38,329,864		probably benign	Het
Anxa2	A	T	9: 69,489,767	Y251F	probably benign	Het
Arid1b	A	G	17: 5,341,813	T1873A	probably damaging	Het
Baz1b	C	A	5: 135,242,524	D1320E	probably benign	Het
Bbs1	A	T	19: 4,894,322	S426R	probably benign	Het
Bid	A	G	6: 120,900,248	V44A	possibly damaging	Het
Ccdc60	T	A	5: 116,172,473	M177L	probably damaging	Het
Cdh23	G	A	10: 60,326,076	T1997M	probably damaging	Het
Cdh5	T	A	8: 104,128,169	M243K	probably benign	Het
Cngb1	C	A	8: 95,299,700	C151F	probably benign	Het
Cntnap5b	T	C	1: 99,772,810	S16P	probably benign	Het
Cr1l	T	A	1: 195,114,815	M305L	probably benign	Het
Ctnnal1	A	T	4: 56,838,988	M235K	probably damaging	Het
Ddx55	A	T	5: 124,568,113	R534W	probably damaging	Het
Dip2b	T	A	15: 100,212,029	L1465Q	probably damaging	Het
Dnah9	G	T	11: 65,981,222	D2727E	probably benign	Het
Dph3b-ps	A	C	13: 106,546,989		noncoding transcript	Het
Dst	T	A	1: 34,228,603	L2702Q	probably damaging	Het
Efnb2	T	C	8: 8,623,184	T158A	possibly damaging	Het
Exosc10	A	T	4: 148,578,469	K712*	probably null	Het
Fgr	T	C	4: 132,998,342	V354A	possibly damaging	Het
Fsip2	G	A	2: 82,984,896	V3658M	probably benign	Het
Fsip2	A	T	2: 82,987,711	H4596L	possibly damaging	Het
Fsip2	A	G	2: 82,999,841	D6893G	possibly damaging	Het
Gm1527	G	A	3: 28,895,550		probably benign	Het
Gm5150	G	T	3: 16,006,304	Q7K	probably benign	Het
Gpr155	C	T	2: 73,381,935	V115M	probably damaging	Het
Gpr75	T	C	11: 30,891,527	L144P	probably damaging	Het
Gsn	T	A	2: 35,284,823	Y127N	probably damaging	Het
Hk1	A	G	10: 62,281,899	L615S	probably damaging	Het
Igsf9b	A	G	9: 27,317,827	T194A	possibly damaging	Het
Il17rd	C	T	14: 27,091,806	Q46*	probably null	Het
Jak1	T	A	4: 101,162,929	M678L	probably benign	Het
Kif6	T	C	17: 49,615,283	V16A	probably benign	Het
Kpna3	T	C	14: 61,370,541	E405G	probably benign	Het
Lmtk2	C	A	5: 144,174,175	T571K	probably damaging	Het
Mucl2	T	C	15: 103,897,572	T40A	possibly damaging	Het
Myh11	G	A	16: 14,233,695		probably benign	Het
Myh7	C	T	14: 54,972,713	R1845Q	probably damaging	Het
Myo1f	T	A	17: 33,586,198	L480Q	probably benign	Het
Nek9	T	G	12: 85,305,590	D833A	possibly damaging	Het
Nek9	T	C	12: 85,310,410	E660G	probably benign	Het
Olfr186	T	C	16: 59,026,987	R307G	probably benign	Het
Olfr315	A	G	11: 58,778,369	M81V	possibly damaging	Het
Olfr419	C	T	1: 174,250,360	C189Y	probably damaging	Het
Olfr446	A	G	6: 42,927,497	I89V	possibly damaging	Het
Olfr523	G	A	7: 140,176,275	V52M	probably damaging	Het
Olfr808	T	A	10: 129,767,548	D17E	probably benign	Het
Olfr831-ps1	T	A	9: 18,932,495		probably benign	Het
Otud3	G	T	4: 138,895,781	T383K	possibly damaging	Het
Pkp4	T	C	2: 59,311,841	L496P	probably damaging	Het
Pla2g4e	C	A	2: 120,170,046	A737S	possibly damaging	Het
Pla2g4f	T	C	2: 120,314,066		probably benign	Het
Plxnd1	A	T	6: 115,967,779	V1018E	possibly damaging	Het
Ppp1r21	T	G	17: 88,562,225	V402G	possibly damaging	Het
Prkcq	T	G	2: 11,300,070	M690R	probably damaging	Het
Ptpra	T	C	2: 130,549,827	I719T	probably damaging	Het
Rab3ip	C	T	10: 116,937,510	D133N	probably damaging	Het
Rsbn1	T	A	3: 103,960,031	Y563N	probably damaging	Het
Rtf1	A	C	2: 119,728,408	D530A	probably benign	Het
Rybp	G	T	6: 100,232,263	S199R	probably benign	Het
Sema5a	T	G	15: 32,641,106	C689G	probably damaging	Het
Senp6	T	A	9: 80,118,629	V314E	probably benign	Het
Setd1a	T	A	7: 127,785,890	C47S	possibly damaging	Het
Slamf1	C	A	1: 171,777,166	T168K	probably benign	Het
Slc12a5	T	C	2: 164,996,128	S937P	probably damaging	Het
Slc38a11	C	T	2: 65,355,319		probably null	Het
Slc6a2	C	T	8: 92,961,218		probably benign	Het
Snw1	A	T	12: 87,464,689	F64Y	probably benign	Het
Spata9	A	C	13: 75,998,524	I172L	probably benign	Het
Sphkap	T	C	1: 83,277,544	H828R	probably benign	Het
Tmem94	A	T	11: 115,796,754	K1146N	probably damaging	Het
Trdn	A	G	10: 33,233,887	T294A	possibly damaging	Het
Tsc22d1	T	C	14: 76,416,948	V289A	possibly damaging	Het
Tti1	C	A	2: 157,993,035	V1002L	possibly damaging	Het
Tubgcp4	T	A	2: 121,189,471		probably null	Het
Ush2a	G	A	1: 188,910,983	E4181K	possibly damaging	Het
Uvrag	A	G	7: 98,888,348	S547P	probably benign	Het
Vav3	T	C	3: 109,341,127	V30A	possibly damaging	Het
Vegfa	A	G	17: 46,025,469	Y242H	probably damaging	Het
Vmn2r75	G	T	7: 86,148,811	T598K	probably damaging	Het
Vps13b	C	T	15: 35,884,619	S3146L	possibly damaging	Het
Vrk3	A	G	7: 44,768,471	Y310C	probably damaging	Het
Zfhx4	A	G	3: 5,382,616	K1100R	probably benign	Het
Zfp748	T	A	13: 67,545,421		probably null	Het
Zfp760	A	T	17: 21,722,330	D162V	probably damaging	Het
Znfx1	T	A	2: 167,039,866	M1068L	probably damaging	Het

Other mutations in Clpb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Clpb	APN	7	101787745	missense	probably benign
IGL00778:Clpb	APN	7	101778608	nonsense	probably null
IGL00780:Clpb	APN	7	101778608	nonsense	probably null
IGL00951:Clpb	APN	7	101751260	missense	probably benign	0.00
IGL01374:Clpb	APN	7	101773128	missense	probably damaging	1.00
IGL01542:Clpb	APN	7	101787505	missense	probably damaging	0.98
IGL02203:Clpb	APN	7	101779337	missense	probably damaging	1.00
IGL02989:Clpb	APN	7	101779220	missense	probably damaging	1.00
IGL03088:Clpb	APN	7	101785449	nonsense	probably null
Surfeit	UTSW	7	101711465	missense	probably damaging	1.00
PIT1430001:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
PIT4486001:Clpb	UTSW	7	101663932	missense	probably benign	0.17
R0611:Clpb	UTSW	7	101787749	missense	possibly damaging	0.71
R1565:Clpb	UTSW	7	101785461	missense	probably benign	0.00
R1879:Clpb	UTSW	7	101706483	missense	probably benign	0.23
R1933:Clpb	UTSW	7	101779211	missense	probably damaging	0.96
R1938:Clpb	UTSW	7	101763656	missense	probably damaging	1.00
R2922:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2923:Clpb	UTSW	7	101722828	missense	probably benign	0.02
R2995:Clpb	UTSW	7	101779324	missense	probably damaging	1.00
R4492:Clpb	UTSW	7	101787722	missense	probably damaging	1.00
R5384:Clpb	UTSW	7	101779341	missense	probably damaging	1.00
R5973:Clpb	UTSW	7	101663997	missense	probably benign	0.02
R6787:Clpb	UTSW	7	101663659	unclassified	probably benign
R7158:Clpb	UTSW	7	101663832	missense	probably benign	0.45
R7225:Clpb	UTSW	7	101711465	missense	probably damaging	1.00
R7239:Clpb	UTSW	7	101711455	missense	probably damaging	0.96
R7482:Clpb	UTSW	7	101786719	missense	possibly damaging	0.95
R7499:Clpb	UTSW	7	101722728	missense	possibly damaging	0.92
R7547:Clpb	UTSW	7	101664296	splice site	probably null
R7769:Clpb	UTSW	7	101722717	missense	probably damaging	0.96
R8279:Clpb	UTSW	7	101706488	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- TCAAAGAACGACCCCAAGGTGATG -3'
(R):5'- GCTCTCAGCCCAGGTTCTTCAAATG -3'

Sequencing Primer
(F):5'- CCCAAGGTGATGTGGGTC -3'
(R):5'- CTTGTTTCAGGCTTCTGTGC -3'

Posted On

2014-05-23