Incidental Mutation 'PIT4486001:Clpb'
ID556102
Institutional Source Beutler Lab
Gene Symbol Clpb
Ensembl Gene ENSMUSG00000001829
Gene NameClpB caseinolytic peptidase B
SynonymsSkd3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #PIT4486001 (G1)
Quality Score140.008
Status Not validated
Chromosome7
Chromosomal Location101663633-101795506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101663932 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 41 (D41V)
Ref Sequence ENSEMBL: ENSMUSP00000001884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001884] [ENSMUST00000106998] [ENSMUST00000123870] [ENSMUST00000209579]
Predicted Effect probably benign
Transcript: ENSMUST00000001884
AA Change: D41V

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000001884
Gene: ENSMUSG00000001829
AA Change: D41V

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 235 264 6.65e-6 SMART
low complexity region 294 306 N/A INTRINSIC
AAA 343 497 6.36e-10 SMART
ClpB_D2-small 541 630 6.83e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106998
AA Change: D41V

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102611
Gene: ENSMUSG00000001829
AA Change: D41V

DomainStartEndE-ValueType
ANK 133 162 2.03e-1 SMART
ANK 166 195 1.96e-3 SMART
ANK 265 294 6.65e-6 SMART
low complexity region 324 336 N/A INTRINSIC
AAA 373 527 6.36e-10 SMART
ClpB_D2-small 571 660 6.83e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123870
AA Change: D41V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000209579
AA Change: D41V

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.5%
  • 10x: 84.1%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ATP-ases associated with diverse cellular activities (AAA+) superfamily. Members of this superfamily form ring-shaped homo-hexamers and have highly conserved ATPase domains that are involved in various processes including DNA replication, protein degradation and reactivation of misfolded proteins. All members of this family hydrolyze ATP through their AAA+ domains and use the energy generated through ATP hydrolysis to exert mechanical force on their substrates. In addition to an AAA+ domain, the protein encoded by this gene contains a C-terminal D2 domain, which is characteristic of the AAA+ subfamily of Caseinolytic peptidases to which this protein belongs. It cooperates with Hsp70 in the disaggregation of protein aggregates. Allelic variants of this gene are associated with 3-methylglutaconic aciduria, which causes cataracts and neutropenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,044,104 S108P probably damaging Het
4930548H24Rik T A 5: 31,487,743 I280K probably damaging Het
4931408C20Rik G A 1: 26,685,329 P257S probably damaging Het
Abhd16b A T 2: 181,493,959 Q218L probably benign Het
Abhd3 T A 18: 10,645,233 I354F probably benign Het
Abt1 T C 13: 23,423,681 Y51C possibly damaging Het
Actl9 T A 17: 33,434,198 Y411N possibly damaging Het
Ano4 A G 10: 88,993,029 V516A probably damaging Het
Bptf A T 11: 107,054,788 S2542T probably damaging Het
Card11 C T 5: 140,876,408 V1045M probably damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cdh3 A G 8: 106,541,490 K386E possibly damaging Het
Cks1b C A 3: 89,416,314 Q49H probably damaging Het
Cyp3a11 A T 5: 145,860,492 M359K probably damaging Het
Cyp3a13 A T 5: 137,909,966 I207N probably benign Het
Dennd4c T A 4: 86,799,464 L566* probably null Het
Dhtkd1 A T 2: 5,899,995 D859E probably benign Het
Efcab6 T C 15: 83,973,313 D295G probably benign Het
Fcgbp A G 7: 28,075,273 T91A possibly damaging Het
Gm11569 GCAGCTGGGCCTGCAGCAGCTGGAAATGCAGCAGCTAGGACGGCAACA GCA 11: 99,798,665 probably benign Het
Gm884 A T 11: 103,618,201 H980Q unknown Het
Gsdma3 A G 11: 98,638,054 K454E unknown Het
Herc1 T A 9: 66,372,389 I193N probably damaging Het
Kdm5b T A 1: 134,628,685 L1370Q probably damaging Het
Map4 T G 9: 110,072,614 V965G probably damaging Het
Mkrn2os T C 6: 115,585,483 D173G probably benign Het
Ndfip2 A G 14: 105,294,866 D232G probably damaging Het
Nipal2 C T 15: 34,584,729 G231D probably damaging Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Olfr150 T A 9: 39,737,239 C141* probably null Het
Olfr493 A G 7: 108,346,322 S220P possibly damaging Het
Prkar2a T C 9: 108,733,127 L185S probably damaging Het
Ptpn9 T G 9: 57,061,003 N542K probably damaging Het
Pus10 G A 11: 23,712,326 probably null Het
Pyroxd2 A G 19: 42,740,389 S191P probably benign Het
Rab15 T A 12: 76,801,942 K122* probably null Het
Rara A G 11: 98,973,495 N416S possibly damaging Het
Rims2 T C 15: 39,476,520 V870A possibly damaging Het
Sec16a T C 2: 26,425,773 T293A Het
Slc26a3 G A 12: 31,470,950 D718N probably benign Het
Slc44a5 G A 3: 154,259,022 V520I possibly damaging Het
Tgfb2 A T 1: 186,690,727 Y142N probably benign Het
Tgfbi A T 13: 56,629,794 I364F probably damaging Het
Tmem144 A C 3: 79,826,867 D176E probably benign Het
Tns4 A T 11: 99,071,335 L612Q probably damaging Het
Toe1 A G 4: 116,806,495 L76S probably damaging Het
Trank1 T C 9: 111,390,107 F1971L probably damaging Het
Tsen54 G T 11: 115,822,596 V481F probably damaging Het
Uimc1 A G 13: 55,075,568 L297P probably damaging Het
Wnt8a T C 18: 34,547,583 Y334H probably damaging Het
Zfp281 A G 1: 136,627,003 D573G possibly damaging Het
Other mutations in Clpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Clpb APN 7 101787745 missense probably benign
IGL00778:Clpb APN 7 101778608 nonsense probably null
IGL00780:Clpb APN 7 101778608 nonsense probably null
IGL00951:Clpb APN 7 101751260 missense probably benign 0.00
IGL01374:Clpb APN 7 101773128 missense probably damaging 1.00
IGL01542:Clpb APN 7 101787505 missense probably damaging 0.98
IGL02203:Clpb APN 7 101779337 missense probably damaging 1.00
IGL02989:Clpb APN 7 101779220 missense probably damaging 1.00
IGL03088:Clpb APN 7 101785449 nonsense probably null
Surfeit UTSW 7 101711465 missense probably damaging 1.00
PIT1430001:Clpb UTSW 7 101786719 missense possibly damaging 0.95
R0611:Clpb UTSW 7 101787749 missense possibly damaging 0.71
R1565:Clpb UTSW 7 101785461 missense probably benign 0.00
R1760:Clpb UTSW 7 101786698 missense possibly damaging 0.92
R1879:Clpb UTSW 7 101706483 missense probably benign 0.23
R1933:Clpb UTSW 7 101779211 missense probably damaging 0.96
R1938:Clpb UTSW 7 101763656 missense probably damaging 1.00
R2922:Clpb UTSW 7 101722828 missense probably benign 0.02
R2923:Clpb UTSW 7 101722828 missense probably benign 0.02
R2995:Clpb UTSW 7 101779324 missense probably damaging 1.00
R4492:Clpb UTSW 7 101787722 missense probably damaging 1.00
R5384:Clpb UTSW 7 101779341 missense probably damaging 1.00
R5973:Clpb UTSW 7 101663997 missense probably benign 0.02
R6787:Clpb UTSW 7 101663659 unclassified probably benign
R7158:Clpb UTSW 7 101663832 missense probably benign 0.45
R7225:Clpb UTSW 7 101711465 missense probably damaging 1.00
R7239:Clpb UTSW 7 101711455 missense probably damaging 0.96
R7482:Clpb UTSW 7 101786719 missense possibly damaging 0.95
R7499:Clpb UTSW 7 101722728 missense possibly damaging 0.92
R7547:Clpb UTSW 7 101664296 intron probably null
R7769:Clpb UTSW 7 101722717 missense probably damaging 0.96
R8279:Clpb UTSW 7 101706488 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTGATCGTGGCTAGCACAGG -3'
(R):5'- TGTAGCACTGAACCACCAGC -3'

Sequencing Primer
(F):5'- CTAGCACAGGGGCCGGC -3'
(R):5'- ACATGCCCAGACCCGTCTTG -3'
Posted On2019-06-07