Incidental Mutation 'R1729:Septin4'
ID 198935
Institutional Source Beutler Lab
Gene Symbol Septin4
Ensembl Gene ENSMUSG00000020486
Gene Name septin 4
Synonyms Gm11492, ARTS, septin H5, cell division control-related protein 2b, Sept4, Bh5, Pnutl2
MMRRC Submission 039761-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.768) question?
Stock # R1729 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87457515-87481365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87474262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 60 (Q60L)
Ref Sequence ENSEMBL: ENSMUSP00000103594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018544] [ENSMUST00000063156] [ENSMUST00000107960] [ENSMUST00000107961] [ENSMUST00000107962] [ENSMUST00000122067] [ENSMUST00000122945] [ENSMUST00000133202]
AlphaFold P28661
Q5ND19
Predicted Effect probably benign
Transcript: ENSMUST00000018544
AA Change: Q60L

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000018544
Gene: ENSMUSG00000020486
AA Change: Q60L

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.8e-130 PFAM
Pfam:MMR_HSR1 146 290 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063156
SMART Domains Protein: ENSMUSP00000060127
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
Pfam:DUF258 26 142 7.5e-7 PFAM
Pfam:Septin 42 322 7.5e-131 PFAM
Pfam:MMR_HSR1 47 211 5.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107960
AA Change: Q60L

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103594
Gene: ENSMUSG00000020486
AA Change: Q60L

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.1e-130 PFAM
Pfam:MMR_HSR1 146 293 7.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107961
SMART Domains Protein: ENSMUSP00000103595
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
Pfam:DUF258 19 135 1e-7 PFAM
Pfam:Septin 35 232 1.9e-89 PFAM
Pfam:MMR_HSR1 40 204 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107962
AA Change: Q41L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103596
Gene: ENSMUSG00000020486
AA Change: Q41L

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Septin 122 402 1.3e-130 PFAM
Pfam:MMR_HSR1 127 273 8.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122067
SMART Domains Protein: ENSMUSP00000112960
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
Pfam:DUF258 8 124 5.3e-7 PFAM
Pfam:Septin 23 303 3.9e-131 PFAM
Pfam:MMR_HSR1 28 172 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135175
Predicted Effect probably benign
Transcript: ENSMUST00000122945
AA Change: Q53L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486
AA Change: Q53L

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133202
AA Change: Q50L

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115790
Gene: ENSMUSG00000020486
AA Change: Q50L

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Pfam:DUF258 114 232 1.4e-7 PFAM
Pfam:Septin 131 280 1.2e-72 PFAM
Pfam:MMR_HSR1 136 279 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132723
Meta Mutation Damage Score 0.1205 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 225 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik G A 15: 37,439,844 (GRCm39) probably benign Het
4930453N24Rik T C 16: 64,589,385 (GRCm39) I90V probably damaging Het
Aadat A G 8: 60,979,746 (GRCm39) T203A probably damaging Het
Adam34l T C 8: 44,078,620 (GRCm39) N535D probably damaging Het
Adamts17 C T 7: 66,799,704 (GRCm39) R1060* probably null Het
Adamts5 T A 16: 85,674,803 (GRCm39) K454* probably null Het
Adgrg6 T C 10: 14,315,526 (GRCm39) T593A probably damaging Het
Aldh1l2 T A 10: 83,343,946 (GRCm39) K377* probably null Het
Aldh4a1 A G 4: 139,371,472 (GRCm39) Y462C probably damaging Het
Ankrd12 G T 17: 66,291,071 (GRCm39) P1454Q probably benign Het
Ap2m1 T A 16: 20,358,088 (GRCm39) N35K probably damaging Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Atr G A 9: 95,779,634 (GRCm39) V1331I probably benign Het
Boc T C 16: 44,316,782 (GRCm39) T454A probably benign Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Car14 G A 3: 95,808,560 (GRCm39) P18L possibly damaging Het
Cbs G T 17: 31,839,923 (GRCm39) A337E probably benign Het
Ccdc186 A C 19: 56,797,652 (GRCm39) H306Q probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cdk12 T C 11: 98,140,796 (GRCm39) probably benign Het
Cep350 A T 1: 155,787,727 (GRCm39) H1370Q probably benign Het
Cfh T C 1: 140,064,526 (GRCm39) K374R probably benign Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chat A T 14: 32,168,752 (GRCm39) L261H probably damaging Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Clcn1 T A 6: 42,276,448 (GRCm39) F360Y possibly damaging Het
Clgn A G 8: 84,149,659 (GRCm39) S387G probably damaging Het
Clk1 C T 1: 58,460,420 (GRCm39) R70Q probably damaging Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Cspg4 G T 9: 56,805,821 (GRCm39) V2211L probably benign Het
Cwh43 T C 5: 73,565,561 (GRCm39) L42P probably damaging Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
D830039M14Rik C T 10: 61,311,506 (GRCm39) probably benign Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Dhx30 T C 9: 109,927,819 (GRCm39) H101R probably damaging Het
Dnah11 T A 12: 117,880,666 (GRCm39) D3818V probably damaging Het
Dnah9 G A 11: 65,975,846 (GRCm39) T1401I possibly damaging Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
Ehf T G 2: 103,104,251 (GRCm39) T186P possibly damaging Het
Elf2 A T 3: 51,164,993 (GRCm39) V277D probably damaging Het
Etnk2 A G 1: 133,291,661 (GRCm39) S54G probably benign Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Eya2 G T 2: 165,529,583 (GRCm39) G109W probably damaging Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fam78b A G 1: 166,829,199 (GRCm39) D22G possibly damaging Het
Fastkd2 T A 1: 63,790,459 (GRCm39) C628* probably null Het
Fat3 A C 9: 15,907,611 (GRCm39) V2797G possibly damaging Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Fut10 T A 8: 31,691,418 (GRCm39) S88T probably benign Het
Gabarap C T 11: 69,882,515 (GRCm39) probably benign Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Gon4l T A 3: 88,810,405 (GRCm39) D1844E probably damaging Het
Gpr25 G A 1: 136,188,448 (GRCm39) P55L probably benign Het
Guk1 A T 11: 59,076,138 (GRCm39) V100E probably damaging Het
Ifi44l T C 3: 151,468,456 (GRCm39) I25V unknown Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Itprid1 T C 6: 55,945,526 (GRCm39) F749S probably benign Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Kif14 A G 1: 136,396,017 (GRCm39) N108D probably benign Het
Kif14 T C 1: 136,453,521 (GRCm39) V1433A probably benign Het
Kif14 T C 1: 136,443,699 (GRCm39) F1291L probably benign Het
Kif14 C T 1: 136,431,169 (GRCm39) L1189F probably benign Het
Kif14 A G 1: 136,418,070 (GRCm39) S868G probably benign Het
Kif14 G A 1: 136,406,103 (GRCm39) A556T probably benign Het
Kif14 A G 1: 136,396,713 (GRCm39) K340E probably damaging Het
Kif18b A G 11: 102,806,367 (GRCm39) probably null Het
Kif26a T C 12: 112,143,219 (GRCm39) S1158P possibly damaging Het
Kmt2d A G 15: 98,763,013 (GRCm39) C279R probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,151,791 (GRCm39) probably benign Het
Krt23 A T 11: 99,383,790 (GRCm39) V34D probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Mb21d2 A G 16: 28,647,173 (GRCm39) V267A probably benign Het
Megf10 T C 18: 57,373,864 (GRCm39) probably null Het
Mfrp A G 9: 44,015,884 (GRCm39) T334A possibly damaging Het
Miga2 A G 2: 30,258,980 (GRCm39) H63R probably damaging Het
Mrgbp T A 2: 180,227,242 (GRCm39) N192K probably damaging Het
Mrgpra2b A G 7: 47,114,627 (GRCm39) I35T probably benign Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Ndufaf7 A T 17: 79,245,058 (GRCm39) K59M probably damaging Het
Necab3 T C 2: 154,388,795 (GRCm39) S208G probably benign Het
Nfrkb C T 9: 31,325,932 (GRCm39) T1125M probably benign Het
Npnt G A 3: 132,620,158 (GRCm39) Q112* probably null Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Nrcam A G 12: 44,620,633 (GRCm39) K893E probably benign Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or8b12i A T 9: 20,082,209 (GRCm39) Y219* probably null Het
Otoa T C 7: 120,724,662 (GRCm39) V447A probably benign Het
Patj G A 4: 98,320,017 (GRCm39) G428D possibly damaging Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Pkn2 G A 3: 142,516,462 (GRCm39) P555S probably benign Het
Pla2g12a A G 3: 129,688,589 (GRCm39) E149G probably benign Het
Plec C A 15: 76,061,892 (GRCm39) E2547* probably null Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Ppfia4 G A 1: 134,227,059 (GRCm39) P1159S probably benign Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Rab3gap1 T G 1: 127,870,223 (GRCm39) L948R probably damaging Het
Rbsn A T 6: 92,167,000 (GRCm39) L548Q possibly damaging Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Rint1 T A 5: 24,014,841 (GRCm39) D352E probably benign Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Rnpep G C 1: 135,211,715 (GRCm39) A11G probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Sctr G A 1: 119,990,987 (GRCm39) S440N possibly damaging Het
Sctr G T 1: 119,990,976 (GRCm39) E453D probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Slain2 A G 5: 73,114,957 (GRCm39) H396R probably damaging Het
Slc22a5 G A 11: 53,757,177 (GRCm39) P491L probably damaging Het
Slc26a4 A G 12: 31,594,493 (GRCm39) V285A possibly damaging Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc26a9 C A 1: 131,693,750 (GRCm39) R747S probably benign Het
Slc9a8 T C 2: 167,266,065 (GRCm39) F14S probably benign Het
Spock3 T C 8: 63,802,011 (GRCm39) L330P probably damaging Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Synpo2l G A 14: 20,715,887 (GRCm39) P233S probably damaging Het
Tasor A T 14: 27,201,590 (GRCm39) N1367Y probably damaging Het
Tbc1d19 T G 5: 53,986,714 (GRCm39) I41S probably damaging Het
Tecta G A 9: 42,303,218 (GRCm39) T138I probably benign Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Tmem241 T A 18: 12,201,369 (GRCm39) H157L probably damaging Het
Tnfrsf25 T A 4: 152,202,761 (GRCm39) probably null Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Traf3ip3 T A 1: 192,864,201 (GRCm39) Q394L probably benign Het
Traf7 A G 17: 24,731,353 (GRCm39) F228L probably damaging Het
Trhr A G 15: 44,060,549 (GRCm39) E23G probably damaging Het
Trim59 T C 3: 68,944,186 (GRCm39) T385A probably benign Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Tubgcp2 T C 7: 139,577,968 (GRCm39) T779A probably benign Het
Tusc2 A T 9: 107,441,830 (GRCm39) I68F probably damaging Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Usp24 A G 4: 106,217,618 (GRCm39) N447S possibly damaging Het
Usp42 T C 5: 143,700,381 (GRCm39) D1214G probably damaging Het
Vmn2r73 T C 7: 85,507,086 (GRCm39) Y742C probably damaging Het
Wdfy4 A T 14: 32,817,962 (GRCm39) S1473T possibly damaging Het
Zan C A 5: 137,413,280 (GRCm39) probably benign Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zfyve9 A C 4: 108,575,698 (GRCm39) V461G possibly damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Other mutations in Septin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Septin4 APN 11 87,480,599 (GRCm39) missense probably damaging 1.00
IGL00963:Septin4 APN 11 87,474,199 (GRCm39) missense possibly damaging 0.89
IGL01803:Septin4 APN 11 87,459,075 (GRCm39) missense probably benign 0.07
IGL01993:Septin4 APN 11 87,458,555 (GRCm39) missense possibly damaging 0.85
IGL02566:Septin4 APN 11 87,458,468 (GRCm39) missense probably benign 0.00
IGL03087:Septin4 APN 11 87,476,071 (GRCm39) splice site probably benign
IGL03213:Septin4 APN 11 87,458,184 (GRCm39) splice site probably null
IGL03268:Septin4 APN 11 87,480,529 (GRCm39) missense probably damaging 0.99
IGL03388:Septin4 APN 11 87,459,042 (GRCm39) nonsense probably null
R0050:Septin4 UTSW 11 87,458,172 (GRCm39) missense probably damaging 1.00
R0077:Septin4 UTSW 11 87,472,022 (GRCm39) missense probably benign
R1479:Septin4 UTSW 11 87,458,244 (GRCm39) missense probably damaging 1.00
R1730:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1739:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1762:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1783:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1784:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1785:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1851:Septin4 UTSW 11 87,459,741 (GRCm39) missense probably damaging 1.00
R1862:Septin4 UTSW 11 87,458,061 (GRCm39) missense possibly damaging 0.48
R1913:Septin4 UTSW 11 87,457,838 (GRCm39) missense probably benign
R1957:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R2131:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2133:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2140:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2141:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2252:Septin4 UTSW 11 87,480,637 (GRCm39) missense possibly damaging 0.75
R3149:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3176:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3276:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3696:Septin4 UTSW 11 87,476,060 (GRCm39) missense possibly damaging 0.48
R4018:Septin4 UTSW 11 87,475,947 (GRCm39) missense probably damaging 1.00
R4021:Septin4 UTSW 11 87,458,106 (GRCm39) missense probably damaging 1.00
R4117:Septin4 UTSW 11 87,459,108 (GRCm39) missense probably damaging 1.00
R4193:Septin4 UTSW 11 87,474,142 (GRCm39) critical splice acceptor site probably null
R4196:Septin4 UTSW 11 87,479,598 (GRCm39) missense probably damaging 0.96
R4332:Septin4 UTSW 11 87,458,730 (GRCm39) missense possibly damaging 0.95
R4515:Septin4 UTSW 11 87,458,883 (GRCm39) missense probably benign
R4663:Septin4 UTSW 11 87,458,429 (GRCm39) missense probably damaging 0.98
R4952:Septin4 UTSW 11 87,458,598 (GRCm39) missense probably benign 0.00
R5012:Septin4 UTSW 11 87,475,230 (GRCm39) missense possibly damaging 0.78
R5015:Septin4 UTSW 11 87,458,043 (GRCm39) missense possibly damaging 0.95
R5149:Septin4 UTSW 11 87,480,071 (GRCm39) missense probably damaging 1.00
R5176:Septin4 UTSW 11 87,458,358 (GRCm39) missense probably benign 0.02
R5711:Septin4 UTSW 11 87,458,723 (GRCm39) missense probably benign 0.07
R5891:Septin4 UTSW 11 87,479,750 (GRCm39) unclassified probably benign
R6090:Septin4 UTSW 11 87,480,343 (GRCm39) missense possibly damaging 0.48
R6145:Septin4 UTSW 11 87,476,072 (GRCm39) splice site probably null
R6257:Septin4 UTSW 11 87,481,175 (GRCm39) missense probably benign 0.07
R6305:Septin4 UTSW 11 87,458,145 (GRCm39) missense probably benign 0.00
R6704:Septin4 UTSW 11 87,479,856 (GRCm39) missense probably damaging 1.00
R7064:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R7090:Septin4 UTSW 11 87,475,264 (GRCm39) missense probably damaging 1.00
R7784:Septin4 UTSW 11 87,469,834 (GRCm39) missense probably benign
R7790:Septin4 UTSW 11 87,480,065 (GRCm39) missense probably damaging 1.00
R8320:Septin4 UTSW 11 87,480,560 (GRCm39) missense possibly damaging 0.68
R9289:Septin4 UTSW 11 87,459,792 (GRCm39) nonsense probably null
R9613:Septin4 UTSW 11 87,469,823 (GRCm39) missense possibly damaging 0.53
T0970:Septin4 UTSW 11 87,458,558 (GRCm39) missense probably damaging 0.98
Z1177:Septin4 UTSW 11 87,458,748 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAACATGTCCTCTGGCTTTGCTG -3'
(R):5'- CTGATGCAGAACAGAAAGGTCCCC -3'

Sequencing Primer
(F):5'- TGCTGTTTCTTTTAACCACACG -3'
(R):5'- TGGAGTCTCTACCTCAGAGGAATC -3'
Posted On 2014-05-23