Incidental Mutation 'R5711:Septin4'
ID 452229
Institutional Source Beutler Lab
Gene Symbol Septin4
Ensembl Gene ENSMUSG00000020486
Gene Name septin 4
Synonyms Gm11492, ARTS, septin H5, cell division control-related protein 2b, Sept4, Bh5, Pnutl2
MMRRC Submission 043185-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.796) question?
Stock # R5711 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87457515-87481365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87458723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 366 (S366P)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
AlphaFold P28661
Q5ND19
Predicted Effect probably benign
Transcript: ENSMUST00000060360
AA Change: S366P

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: S366P

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 A T 13: 100,790,722 (GRCm39) T18S probably damaging Het
Aqp7 G A 4: 41,035,510 (GRCm39) T115I probably benign Het
Arhgap19 A G 19: 41,773,227 (GRCm39) V275A possibly damaging Het
Cebpz T A 17: 79,242,040 (GRCm39) Q538L probably damaging Het
Chgb A T 2: 132,634,618 (GRCm39) I187F probably benign Het
Cldn1 C A 16: 26,190,167 (GRCm39) L70F probably damaging Het
Crybg2 A T 4: 133,809,938 (GRCm39) D1230V probably damaging Het
Csmd1 C T 8: 16,003,703 (GRCm39) C2617Y probably damaging Het
D7Ertd443e T A 7: 133,951,110 (GRCm39) N188Y probably benign Het
Ddx51 A G 5: 110,802,790 (GRCm39) I214M probably benign Het
Dlg5 A G 14: 24,200,716 (GRCm39) V1328A probably damaging Het
Dnah2 C T 11: 69,326,216 (GRCm39) C3639Y probably damaging Het
Dync1i2 C T 2: 71,081,326 (GRCm39) T511I probably benign Het
Fam220a A T 5: 143,549,212 (GRCm39) E208V probably damaging Het
Gm4846 T C 1: 166,311,594 (GRCm39) S422G probably benign Het
Grin2c C T 11: 115,141,115 (GRCm39) R1001Q probably benign Het
H2-T3 T C 17: 36,498,301 (GRCm39) E248G probably damaging Het
Idi2 T C 13: 9,008,518 (GRCm39) V92A probably benign Het
Iqcd C T 5: 120,740,571 (GRCm39) Q301* probably null Het
Klhl26 T C 8: 70,904,974 (GRCm39) D278G probably damaging Het
Mok G T 12: 110,774,503 (GRCm39) T228K probably damaging Het
Or1e22 A G 11: 73,377,008 (GRCm39) I214T probably damaging Het
Otogl G A 10: 107,612,978 (GRCm39) silent Het
Pabpc1 T C 15: 36,606,074 (GRCm39) I101V probably benign Het
Ppargc1a G T 5: 51,631,562 (GRCm39) Q356K probably damaging Het
Ptprt T A 2: 161,652,524 (GRCm39) D608V probably damaging Het
Rxfp1 C T 3: 79,586,054 (GRCm39) C96Y probably damaging Het
Scn11a A C 9: 119,618,990 (GRCm39) V784G probably damaging Het
Slc12a8 A G 16: 33,410,679 (GRCm39) Y226C probably damaging Het
Slc25a33 A G 4: 149,846,914 (GRCm39) V49A possibly damaging Het
Slc25a45 T C 19: 5,934,451 (GRCm39) S140P probably benign Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Spty2d1 G T 7: 46,647,845 (GRCm39) N361K possibly damaging Het
Stk4 G A 2: 163,941,674 (GRCm39) A297T probably benign Het
Thsd7b T A 1: 129,688,139 (GRCm39) N683K probably damaging Het
Tln2 T C 9: 67,299,829 (GRCm39) E141G probably benign Het
Tmem125 A T 4: 118,399,216 (GRCm39) C72S probably damaging Het
Ttn G T 2: 76,572,437 (GRCm39) T26152K probably damaging Het
Uhrf1 G A 17: 56,627,259 (GRCm39) G643D possibly damaging Het
Vmn2r50 C T 7: 9,774,299 (GRCm39) M532I possibly damaging Het
Other mutations in Septin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Septin4 APN 11 87,480,599 (GRCm39) missense probably damaging 1.00
IGL00963:Septin4 APN 11 87,474,199 (GRCm39) missense possibly damaging 0.89
IGL01803:Septin4 APN 11 87,459,075 (GRCm39) missense probably benign 0.07
IGL01993:Septin4 APN 11 87,458,555 (GRCm39) missense possibly damaging 0.85
IGL02566:Septin4 APN 11 87,458,468 (GRCm39) missense probably benign 0.00
IGL03087:Septin4 APN 11 87,476,071 (GRCm39) splice site probably benign
IGL03213:Septin4 APN 11 87,458,184 (GRCm39) splice site probably null
IGL03268:Septin4 APN 11 87,480,529 (GRCm39) missense probably damaging 0.99
IGL03388:Septin4 APN 11 87,459,042 (GRCm39) nonsense probably null
R0050:Septin4 UTSW 11 87,458,172 (GRCm39) missense probably damaging 1.00
R0077:Septin4 UTSW 11 87,472,022 (GRCm39) missense probably benign
R1479:Septin4 UTSW 11 87,458,244 (GRCm39) missense probably damaging 1.00
R1729:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1730:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1739:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1762:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1783:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1784:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1785:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1851:Septin4 UTSW 11 87,459,741 (GRCm39) missense probably damaging 1.00
R1862:Septin4 UTSW 11 87,458,061 (GRCm39) missense possibly damaging 0.48
R1913:Septin4 UTSW 11 87,457,838 (GRCm39) missense probably benign
R1957:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R2131:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2133:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2140:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2141:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2252:Septin4 UTSW 11 87,480,637 (GRCm39) missense possibly damaging 0.75
R3149:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3176:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3276:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3696:Septin4 UTSW 11 87,476,060 (GRCm39) missense possibly damaging 0.48
R4018:Septin4 UTSW 11 87,475,947 (GRCm39) missense probably damaging 1.00
R4021:Septin4 UTSW 11 87,458,106 (GRCm39) missense probably damaging 1.00
R4117:Septin4 UTSW 11 87,459,108 (GRCm39) missense probably damaging 1.00
R4193:Septin4 UTSW 11 87,474,142 (GRCm39) critical splice acceptor site probably null
R4196:Septin4 UTSW 11 87,479,598 (GRCm39) missense probably damaging 0.96
R4332:Septin4 UTSW 11 87,458,730 (GRCm39) missense possibly damaging 0.95
R4515:Septin4 UTSW 11 87,458,883 (GRCm39) missense probably benign
R4663:Septin4 UTSW 11 87,458,429 (GRCm39) missense probably damaging 0.98
R4952:Septin4 UTSW 11 87,458,598 (GRCm39) missense probably benign 0.00
R5012:Septin4 UTSW 11 87,475,230 (GRCm39) missense possibly damaging 0.78
R5015:Septin4 UTSW 11 87,458,043 (GRCm39) missense possibly damaging 0.95
R5149:Septin4 UTSW 11 87,480,071 (GRCm39) missense probably damaging 1.00
R5176:Septin4 UTSW 11 87,458,358 (GRCm39) missense probably benign 0.02
R5891:Septin4 UTSW 11 87,479,750 (GRCm39) unclassified probably benign
R6090:Septin4 UTSW 11 87,480,343 (GRCm39) missense possibly damaging 0.48
R6145:Septin4 UTSW 11 87,476,072 (GRCm39) splice site probably null
R6257:Septin4 UTSW 11 87,481,175 (GRCm39) missense probably benign 0.07
R6305:Septin4 UTSW 11 87,458,145 (GRCm39) missense probably benign 0.00
R6704:Septin4 UTSW 11 87,479,856 (GRCm39) missense probably damaging 1.00
R7064:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R7090:Septin4 UTSW 11 87,475,264 (GRCm39) missense probably damaging 1.00
R7784:Septin4 UTSW 11 87,469,834 (GRCm39) missense probably benign
R7790:Septin4 UTSW 11 87,480,065 (GRCm39) missense probably damaging 1.00
R8320:Septin4 UTSW 11 87,480,560 (GRCm39) missense possibly damaging 0.68
R9289:Septin4 UTSW 11 87,459,792 (GRCm39) nonsense probably null
R9613:Septin4 UTSW 11 87,469,823 (GRCm39) missense possibly damaging 0.53
T0970:Septin4 UTSW 11 87,458,558 (GRCm39) missense probably damaging 0.98
Z1177:Septin4 UTSW 11 87,458,748 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATTGGGACCAAGCCCTC -3'
(R):5'- CACAGAAAGGGGTTGAGTCC -3'

Sequencing Primer
(F):5'- TCCCCAAAGATTTTAATATCCGAAGC -3'
(R):5'- AGGCGACTTAGGTTCAAGATC -3'
Posted On 2017-01-03