Incidental Mutation 'R0112:Parg'
ID20539
Institutional Source Beutler Lab
Gene Symbol Parg
Ensembl Gene ENSMUSG00000021911
Gene Namepoly (ADP-ribose) glycohydrolase
Synonyms
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0112 (G1)
Quality Score70
Status Validated (trace)
Chromosome14
Chromosomal Location32201949-32297550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32202433 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 63 (A63E)
Ref Sequence ENSEMBL: ENSMUSP00000127362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013845] [ENSMUST00000022470] [ENSMUST00000163350] [ENSMUST00000163379] [ENSMUST00000164137] [ENSMUST00000170129] [ENSMUST00000170331] [ENSMUST00000170840] [ENSMUST00000171279] [ENSMUST00000226683]
Predicted Effect probably benign
Transcript: ENSMUST00000013845
SMART Domains Protein: ENSMUSP00000013845
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Pfam:Tim17 76 196 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022470
AA Change: A63E

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022470
Gene: ENSMUSG00000021911
AA Change: A63E

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 574 902 2.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163350
AA Change: A63E

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131566
Gene: ENSMUSG00000021911
AA Change: A63E

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 570 905 5.1e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163379
SMART Domains Protein: ENSMUSP00000129688
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164137
AA Change: A63E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168813
Predicted Effect probably damaging
Transcript: ENSMUST00000170129
AA Change: A63E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170233
Predicted Effect probably benign
Transcript: ENSMUST00000170331
SMART Domains Protein: ENSMUSP00000126977
Gene: ENSMUSG00000013701

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170637
Predicted Effect probably benign
Transcript: ENSMUST00000170840
SMART Domains Protein: ENSMUSP00000132454
Gene: ENSMUSG00000021911

DomainStartEndE-ValueType
Pfam:PARG_cat 117 452 9.7e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172052
Predicted Effect probably benign
Transcript: ENSMUST00000171279
SMART Domains Protein: ENSMUSP00000128629
Gene: ENSMUSG00000021911

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226683
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) glycohydrolase (PARG) is the major enzyme responsible for the catabolism of poly(ADP-ribose), a reversible covalent-modifier of chromosomal proteins. The protein is found in many tissues and may be subject to proteolysis generating smaller, active products. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for one allele of this gene are hypersensitive to alkylating agents and ionizing radiation and susceptible to streptozotocin induced diabetes and endotoxic shock. Mice homozygous for a second allele display embryonic lethality and fail tohatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Parg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Parg APN 14 32296185 splice site probably benign
IGL01879:Parg APN 14 32271622 splice site probably benign
IGL02391:Parg APN 14 32262681 splice site probably null
IGL02451:Parg APN 14 32242229 missense probably damaging 1.00
IGL02598:Parg APN 14 32214324 missense probably damaging 1.00
IGL02899:Parg APN 14 32238574 missense probably damaging 1.00
R0167:Parg UTSW 14 32217736 critical splice donor site probably null
R0514:Parg UTSW 14 32254560 missense possibly damaging 0.69
R0834:Parg UTSW 14 32214554 splice site probably benign
R1140:Parg UTSW 14 32296243 missense probably benign 0.01
R1480:Parg UTSW 14 32209628 nonsense probably null
R1611:Parg UTSW 14 32238570 missense probably damaging 1.00
R1912:Parg UTSW 14 32210540 missense probably damaging 0.99
R1916:Parg UTSW 14 32208227 splice site probably benign
R1983:Parg UTSW 14 32217696 missense probably damaging 1.00
R2007:Parg UTSW 14 32210574 missense possibly damaging 0.87
R2275:Parg UTSW 14 32295238 missense probably damaging 0.98
R2942:Parg UTSW 14 32209337 missense probably damaging 1.00
R4206:Parg UTSW 14 32254536 missense probably benign 0.07
R4482:Parg UTSW 14 32262774 missense probably damaging 1.00
R4512:Parg UTSW 14 32262736 missense probably damaging 1.00
R4519:Parg UTSW 14 32209635 missense probably damaging 1.00
R4611:Parg UTSW 14 32274864 missense probably damaging 1.00
R4831:Parg UTSW 14 32202451 missense probably benign 0.00
R4876:Parg UTSW 14 32271668 missense probably damaging 0.98
R5298:Parg UTSW 14 32202253 missense probably damaging 1.00
R5606:Parg UTSW 14 32262736 missense probably damaging 1.00
R5782:Parg UTSW 14 32274905 nonsense probably null
R5878:Parg UTSW 14 32217662 missense possibly damaging 0.85
R6373:Parg UTSW 14 32209497 splice site probably null
R6436:Parg UTSW 14 32271677 missense probably damaging 1.00
R6530:Parg UTSW 14 32209199 missense probably damaging 1.00
R7285:Parg UTSW 14 32210508 missense probably damaging 0.98
R7348:Parg UTSW 14 32250079 missense possibly damaging 0.82
R7455:Parg UTSW 14 32209475 missense probably benign
R7780:Parg UTSW 14 32208801 missense possibly damaging 0.94
R7887:Parg UTSW 14 32217662 missense possibly damaging 0.85
R7968:Parg UTSW 14 32214370 missense possibly damaging 0.57
R8153:Parg UTSW 14 32262820 missense probably damaging 1.00
R8494:Parg UTSW 14 32209021 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAAGTATCGCACTTCCGCTTTACG -3'
(R):5'- AGGTCCGGTAACTACCTGTCCAAC -3'

Sequencing Primer
(F):5'- TAGTGAATGAGGCTCTCCGC -3'
(R):5'- CTGGTCCTCACACTGAAACA -3'
Posted On2013-04-11