Incidental Mutation 'R1895:Glmn'
ID209729
Institutional Source Beutler Lab
Gene Symbol Glmn
Ensembl Gene ENSMUSG00000029276
Gene Nameglomulin, FKBP associated protein
Synonyms9330160J16Rik, Fap48, Fap68
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107548967-107597888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107570244 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000098509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000124546]
Predicted Effect probably benign
Transcript: ENSMUST00000078021
AA Change: D269G

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276
AA Change: D269G

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082121
AA Change: D269G

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276
AA Change: D269G

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100949
AA Change: D269G

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276
AA Change: D269G

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148505
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphorylated protein that is a member of a Skp1-Cullin-F-box-like complex. The protein is essential for normal development of the vasculature and mutations in this gene have been associated with glomuvenous malformations, also called glomangiomas. Multiple splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete embryonic lethality during organogenesis associated with growth retardation, delayed neural tube closure, incomplete embryo turning, pericardial effusion, disorganized yolk sac vascular plexus and head mesenchyme hypocellularity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col4a3 A T 1: 82,679,108 K749N unknown Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Glmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Glmn APN 5 107570139 missense possibly damaging 0.79
IGL00925:Glmn APN 5 107557327 missense probably damaging 1.00
IGL01092:Glmn APN 5 107578512 critical splice acceptor site probably null
IGL02503:Glmn APN 5 107562778 missense probably damaging 0.98
IGL02725:Glmn APN 5 107575289 missense possibly damaging 0.95
IGL03116:Glmn APN 5 107551083 missense probably damaging 1.00
mauna_kea UTSW 5 107593880 critical splice acceptor site probably null
pillow UTSW 5 107549075 missense probably benign 0.20
R0078:Glmn UTSW 5 107557970 missense probably benign 0.31
R0115:Glmn UTSW 5 107560934 missense probably benign 0.00
R0481:Glmn UTSW 5 107560934 missense probably benign 0.00
R1954:Glmn UTSW 5 107572377 missense probably damaging 1.00
R2090:Glmn UTSW 5 107561928 missense probably damaging 1.00
R2132:Glmn UTSW 5 107578455 missense probably damaging 0.98
R3962:Glmn UTSW 5 107561045 intron probably benign
R4296:Glmn UTSW 5 107558502 missense possibly damaging 0.52
R4591:Glmn UTSW 5 107561051 critical splice donor site probably null
R4679:Glmn UTSW 5 107561075 missense probably damaging 1.00
R4992:Glmn UTSW 5 107557301 missense probably damaging 1.00
R5140:Glmn UTSW 5 107570200 missense probably damaging 0.99
R5215:Glmn UTSW 5 107561886 missense probably benign 0.03
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6116:Glmn UTSW 5 107557340 missense probably damaging 1.00
R6671:Glmn UTSW 5 107549414 missense probably benign 0.37
R7748:Glmn UTSW 5 107562244 critical splice donor site probably null
R7789:Glmn UTSW 5 107549075 missense probably benign 0.20
R8407:Glmn UTSW 5 107570191 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTGCCATCTTTCAGTGTACTAGTA -3'
(R):5'- TGCACATGCGCCTTTAATTATGA -3'

Sequencing Primer
(F):5'- ATACCGATGCCCTGAACA -3'
(R):5'- GGCTTTTGAAACCTCAGAGC -3'
Posted On2014-06-30