Incidental Mutation 'R1895:Col4a3'
ID209703
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Namecollagen, type IV, alpha 3
Synonymsalpha3(IV), tumstatin
MMRRC Submission 039915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1895 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location82586921-82722059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82679108 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 749 (K749N)
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457]
Predicted Effect unknown
Transcript: ENSMUST00000113457
AA Change: K749N
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: K749N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 97.1%
  • 3x: 96.2%
  • 10x: 93.2%
  • 20x: 86.6%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,891,704 S253P probably damaging Het
Adgrb1 A G 15: 74,540,465 D431G probably damaging Het
Adgrv1 C T 13: 81,374,249 C5923Y probably damaging Het
Akr1b10 T A 6: 34,388,870 I110N probably damaging Het
Apba2 T C 7: 64,744,630 probably null Het
Arhgef12 G T 9: 43,005,856 Q396K probably damaging Het
Arpc1b A G 5: 145,122,633 T56A probably null Het
Atoh1 T C 6: 64,729,459 V46A probably benign Het
AU015836 T C X: 93,969,379 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Capn13 T C 17: 73,350,525 E240G possibly damaging Het
Cdh8 T C 8: 99,279,557 T133A possibly damaging Het
Cep295 T C 9: 15,332,103 T1686A possibly damaging Het
Col6a3 T A 1: 90,803,711 M1000L probably benign Het
Coq8b G A 7: 27,239,874 V150I possibly damaging Het
Dmxl1 G T 18: 49,955,914 probably null Het
Dnah10 A G 5: 124,758,430 D990G probably benign Het
Dpp7 G T 2: 25,353,679 probably null Het
Eif3l A G 15: 79,089,477 N364S possibly damaging Het
Epb41l5 T C 1: 119,549,172 D718G possibly damaging Het
F930017D23Rik G A 10: 43,593,444 noncoding transcript Het
Fam20a T C 11: 109,673,554 K458E probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fut2 A G 7: 45,651,324 F8S probably damaging Het
Gad2 A T 2: 22,685,428 T515S probably benign Het
Glmn T C 5: 107,570,244 D269G probably benign Het
Gm13119 T A 4: 144,361,865 V77E probably benign Het
Gpatch4 A G 3: 88,052,102 Y106C probably damaging Het
Grm3 A G 5: 9,512,123 W576R probably damaging Het
Hdac7 T C 15: 97,796,886 D701G probably damaging Het
Hectd2 T A 19: 36,614,460 I687K probably damaging Het
Hmcn2 T C 2: 31,405,635 S2619P probably damaging Het
Ilf3 T A 9: 21,404,767 probably benign Het
Kdm4b T A 17: 56,397,340 V272E probably damaging Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif11 G A 19: 37,387,399 R220K probably damaging Het
Kmt2c A T 5: 25,315,154 V1986E probably benign Het
Lrp11 T C 10: 7,623,776 Y244H probably damaging Het
Lrp1b T A 2: 40,665,147 D320V unknown Het
Map4k5 A T 12: 69,845,755 D133E probably damaging Het
Megf11 A T 9: 64,679,276 D461V probably damaging Het
Muc5b A C 7: 141,857,645 T1443P unknown Het
Mxi1 G A 19: 53,370,344 R236H probably benign Het
Nav1 A T 1: 135,458,658 W1211R probably damaging Het
Ncoa3 T A 2: 166,059,177 N896K possibly damaging Het
Nmt2 T A 2: 3,322,635 I355N probably benign Het
Nxpe5 T C 5: 138,251,523 V525A probably damaging Het
Oas1f A T 5: 120,855,585 T287S probably benign Het
Olfr1354 T A 10: 78,916,924 I28N probably damaging Het
Olfr147 T A 9: 38,402,886 M1K probably null Het
Olfr290 T C 7: 84,916,279 S167P probably benign Het
Olfr353 A T 2: 36,890,446 M134K possibly damaging Het
Olfr522 T A 7: 140,162,813 I46F possibly damaging Het
Palm2 T C 4: 57,638,068 V35A probably benign Het
Panx1 A G 9: 15,007,526 C346R probably benign Het
Plekha7 T C 7: 116,144,974 E764G probably damaging Het
Plet1 A G 9: 50,504,352 probably null Het
Plod2 A G 9: 92,607,135 S707G probably damaging Het
Plscr4 G A 9: 92,483,836 V120I probably damaging Het
Prob1 T A 18: 35,652,889 T771S possibly damaging Het
Rasa3 A G 8: 13,631,768 probably benign Het
Ror2 T C 13: 53,131,849 I110V probably damaging Het
Sec24d A T 3: 123,353,394 H667L probably benign Het
Sema3d A G 5: 12,573,843 Q573R probably damaging Het
Serpinb2 T A 1: 107,524,607 V305D probably damaging Het
Slc11a2 G A 15: 100,403,894 R249C probably benign Het
Slc14a1 T C 18: 78,109,697 I276V possibly damaging Het
Snx19 T A 9: 30,432,324 N593K probably damaging Het
Ssh2 C G 11: 77,449,745 D574E probably damaging Het
Stil T C 4: 115,023,875 S539P probably benign Het
Syt4 T C 18: 31,444,088 K71R probably damaging Het
Tenm4 A T 7: 96,735,808 H524L probably damaging Het
Tex30 C T 1: 44,091,404 G68D probably damaging Het
Tm4sf19 A G 16: 32,407,682 Y138C probably damaging Het
Tmem43 A T 6: 91,486,909 I389F probably benign Het
Trpm1 A T 7: 64,223,808 N488Y probably damaging Het
Tshz1 A T 18: 84,013,433 L950Q probably damaging Het
Vmn1r16 T C 6: 57,322,900 I246V probably benign Het
Vmn1r188 T G 13: 22,088,645 S256R possibly damaging Het
Zfp12 G A 5: 143,245,378 E487K probably damaging Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82697754 missense unknown
IGL00847:Col4a3 APN 1 82717869 missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82682301 missense unknown
IGL01102:Col4a3 APN 1 82669720 missense unknown
IGL01102:Col4a3 APN 1 82670255 missense unknown
IGL02071:Col4a3 APN 1 82660887 critical splice donor site probably null
IGL02244:Col4a3 APN 1 82669771 splice site probably benign
IGL02380:Col4a3 APN 1 82672788 splice site probably benign
IGL02431:Col4a3 APN 1 82679623 nonsense probably null
IGL02466:Col4a3 APN 1 82670192 missense unknown
IGL02694:Col4a3 APN 1 82710794 unclassified probably benign
IGL02709:Col4a3 APN 1 82679112 missense unknown
IGL02752:Col4a3 APN 1 82660225 missense unknown
IGL02792:Col4a3 APN 1 82718803 missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82672639 nonsense probably null
IGL03218:Col4a3 APN 1 82643206 splice site probably benign
FR4976:Col4a3 UTSW 1 82718906 frame shift probably null
PIT4260001:Col4a3 UTSW 1 82682761 missense unknown
PIT4515001:Col4a3 UTSW 1 82682303 missense unknown
R0035:Col4a3 UTSW 1 82672753 missense unknown
R0099:Col4a3 UTSW 1 82717993 missense probably benign 0.41
R0433:Col4a3 UTSW 1 82670219 missense unknown
R0573:Col4a3 UTSW 1 82716363 missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82672586 splice site probably benign
R0715:Col4a3 UTSW 1 82652158 splice site probably benign
R0961:Col4a3 UTSW 1 82708576 splice site probably benign
R1257:Col4a3 UTSW 1 82716365 missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82643301 splice site probably benign
R1373:Col4a3 UTSW 1 82690087 splice site probably benign
R1694:Col4a3 UTSW 1 82690663 splice site probably null
R1925:Col4a3 UTSW 1 82700373 missense unknown
R1925:Col4a3 UTSW 1 82711874 unclassified probably benign
R2033:Col4a3 UTSW 1 82718011 intron probably benign
R2044:Col4a3 UTSW 1 82696319 missense unknown
R2122:Col4a3 UTSW 1 82654957 missense unknown
R2282:Col4a3 UTSW 1 82708638 missense unknown
R2318:Col4a3 UTSW 1 82648569 splice site probably null
R2421:Col4a3 UTSW 1 82670275 splice site probably benign
R2517:Col4a3 UTSW 1 82680710 missense unknown
R2965:Col4a3 UTSW 1 82648600 missense unknown
R3085:Col4a3 UTSW 1 82651258 missense unknown
R3150:Col4a3 UTSW 1 82657137 splice site probably null
R3947:Col4a3 UTSW 1 82715332 missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82716297 critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82672679 missense unknown
R4928:Col4a3 UTSW 1 82710977 unclassified probably benign
R5044:Col4a3 UTSW 1 82666546 missense unknown
R5557:Col4a3 UTSW 1 82715247 unclassified probably benign
R5761:Col4a3 UTSW 1 82716057 nonsense probably null
R5970:Col4a3 UTSW 1 82716329 missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82708574 intron probably null
R6583:Col4a3 UTSW 1 82641476 missense unknown
R6675:Col4a3 UTSW 1 82668925 missense unknown
R7170:Col4a3 UTSW 1 82715909 intron probably null
R7592:Col4a3 UTSW 1 82648617 missense unknown
R7624:Col4a3 UTSW 1 82718884 missense probably benign
X0067:Col4a3 UTSW 1 82716159 missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82690039 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCTGACGCAACATTAAGCAG -3'
(R):5'- GAGACACAAATGCTTAGAGCCC -3'

Sequencing Primer
(F):5'- CGCAACATTAAGCAGAATTTTGTACC -3'
(R):5'- CCCCTAGAGCACCCACAG -3'
Posted On2014-06-30