Mutagenetix > Incidental Mutation

Incidental Mutation 'R1895:Col4a3'

209703

Institutional Source

Beutler Lab

Gene Symbol

Col4a3

Ensembl Gene

ENSMUSG00000079465

Gene Name

collagen, type IV, alpha 3

Synonyms

alpha3(IV), tumstatin

MMRRC Submission

039915-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1895 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82586921-82722059 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82679108 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 749 (K749N)

Ref Sequence

ENSEMBL: ENSMUSP00000109084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113457]

AlphaFold

Q9QZS0

Predicted Effect

unknown
Transcript: ENSMUST00000113457
AA Change: K749N

SMART Domains

Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465
AA Change: K749N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Collagen	41	102	9.6e-11	PFAM
Pfam:Collagen	97	164	3.6e-11	PFAM
Pfam:Collagen	164	223	3.6e-9	PFAM
low complexity region	233	243	N/A	INTRINSIC
Pfam:Collagen	284	344	2.4e-10	PFAM
low complexity region	368	393	N/A	INTRINSIC
Pfam:Collagen	415	477	5e-10	PFAM
Pfam:Collagen	481	545	1e-9	PFAM
low complexity region	550	585	N/A	INTRINSIC
Pfam:Collagen	588	653	8.9e-9	PFAM
Pfam:Collagen	682	744	1.1e-8	PFAM
Pfam:Collagen	743	807	6.9e-10	PFAM
Pfam:Collagen	786	847	1.5e-8	PFAM
Pfam:Collagen	845	904	1.5e-10	PFAM
Pfam:Collagen	887	946	4.1e-10	PFAM
Pfam:Collagen	948	1006	8.1e-11	PFAM
Pfam:Collagen	997	1061	2.8e-10	PFAM
Pfam:Collagen	1057	1120	2.5e-10	PFAM
Pfam:Collagen	1114	1176	1.7e-9	PFAM
Pfam:Collagen	1174	1233	1.1e-9	PFAM
Pfam:Collagen	1232	1295	6.9e-9	PFAM
low complexity region	1326	1347	N/A	INTRINSIC
Pfam:Collagen	1377	1439	4.9e-11	PFAM
C4	1444	1553	3.77e-70	SMART
C4	1554	1667	3.28e-70	SMART

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 97.1%
3x: 96.2%
10x: 93.2%
20x: 86.6%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	G	5: 76,891,704	S253P	probably damaging	Het
Adgrb1	A	G	15: 74,540,465	D431G	probably damaging	Het
Adgrv1	C	T	13: 81,374,249	C5923Y	probably damaging	Het
Akr1b10	T	A	6: 34,388,870	I110N	probably damaging	Het
Apba2	T	C	7: 64,744,630		probably null	Het
Arhgef12	G	T	9: 43,005,856	Q396K	probably damaging	Het
Arpc1b	A	G	5: 145,122,633	T56A	probably null	Het
Atoh1	T	C	6: 64,729,459	V46A	probably benign	Het
AU015836	T	C	X: 93,969,379		probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Capn13	T	C	17: 73,350,525	E240G	possibly damaging	Het
Cdh8	T	C	8: 99,279,557	T133A	possibly damaging	Het
Cep295	T	C	9: 15,332,103	T1686A	possibly damaging	Het
Col6a3	T	A	1: 90,803,711	M1000L	probably benign	Het
Coq8b	G	A	7: 27,239,874	V150I	possibly damaging	Het
Dmxl1	G	T	18: 49,955,914		probably null	Het
Dnah10	A	G	5: 124,758,430	D990G	probably benign	Het
Dpp7	G	T	2: 25,353,679		probably null	Het
Eif3l	A	G	15: 79,089,477	N364S	possibly damaging	Het
Epb41l5	T	C	1: 119,549,172	D718G	possibly damaging	Het
F930017D23Rik	G	A	10: 43,593,444		noncoding transcript	Het
Fam20a	T	C	11: 109,673,554	K458E	probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fut2	A	G	7: 45,651,324	F8S	probably damaging	Het
Gad2	A	T	2: 22,685,428	T515S	probably benign	Het
Glmn	T	C	5: 107,570,244	D269G	probably benign	Het
Gm13119	T	A	4: 144,361,865	V77E	probably benign	Het
Gpatch4	A	G	3: 88,052,102	Y106C	probably damaging	Het
Grm3	A	G	5: 9,512,123	W576R	probably damaging	Het
Hdac7	T	C	15: 97,796,886	D701G	probably damaging	Het
Hectd2	T	A	19: 36,614,460	I687K	probably damaging	Het
Hmcn2	T	C	2: 31,405,635	S2619P	probably damaging	Het
Ilf3	T	A	9: 21,404,767		probably benign	Het
Kdm4b	T	A	17: 56,397,340	V272E	probably damaging	Het
Kera	A	G	10: 97,609,147	K123E	probably benign	Het
Kif11	G	A	19: 37,387,399	R220K	probably damaging	Het
Kmt2c	A	T	5: 25,315,154	V1986E	probably benign	Het
Lrp11	T	C	10: 7,623,776	Y244H	probably damaging	Het
Lrp1b	T	A	2: 40,665,147	D320V	unknown	Het
Map4k5	A	T	12: 69,845,755	D133E	probably damaging	Het
Megf11	A	T	9: 64,679,276	D461V	probably damaging	Het
Muc5b	A	C	7: 141,857,645	T1443P	unknown	Het
Mxi1	G	A	19: 53,370,344	R236H	probably benign	Het
Nav1	A	T	1: 135,458,658	W1211R	probably damaging	Het
Ncoa3	T	A	2: 166,059,177	N896K	possibly damaging	Het
Nmt2	T	A	2: 3,322,635	I355N	probably benign	Het
Nxpe5	T	C	5: 138,251,523	V525A	probably damaging	Het
Oas1f	A	T	5: 120,855,585	T287S	probably benign	Het
Olfr1354	T	A	10: 78,916,924	I28N	probably damaging	Het
Olfr147	T	A	9: 38,402,886	M1K	probably null	Het
Olfr290	T	C	7: 84,916,279	S167P	probably benign	Het
Olfr353	A	T	2: 36,890,446	M134K	possibly damaging	Het
Olfr522	T	A	7: 140,162,813	I46F	possibly damaging	Het
Palm2	T	C	4: 57,638,068	V35A	probably benign	Het
Panx1	A	G	9: 15,007,526	C346R	probably benign	Het
Plekha7	T	C	7: 116,144,974	E764G	probably damaging	Het
Plet1	A	G	9: 50,504,352		probably null	Het
Plod2	A	G	9: 92,607,135	S707G	probably damaging	Het
Plscr4	G	A	9: 92,483,836	V120I	probably damaging	Het
Prob1	T	A	18: 35,652,889	T771S	possibly damaging	Het
Rasa3	A	G	8: 13,631,768		probably benign	Het
Ror2	T	C	13: 53,131,849	I110V	probably damaging	Het
Sec24d	A	T	3: 123,353,394	H667L	probably benign	Het
Sema3d	A	G	5: 12,573,843	Q573R	probably damaging	Het
Serpinb2	T	A	1: 107,524,607	V305D	probably damaging	Het
Slc11a2	G	A	15: 100,403,894	R249C	probably benign	Het
Slc14a1	T	C	18: 78,109,697	I276V	possibly damaging	Het
Snx19	T	A	9: 30,432,324	N593K	probably damaging	Het
Ssh2	C	G	11: 77,449,745	D574E	probably damaging	Het
Stil	T	C	4: 115,023,875	S539P	probably benign	Het
Syt4	T	C	18: 31,444,088	K71R	probably damaging	Het
Tenm4	A	T	7: 96,735,808	H524L	probably damaging	Het
Tex30	C	T	1: 44,091,404	G68D	probably damaging	Het
Tm4sf19	A	G	16: 32,407,682	Y138C	probably damaging	Het
Tmem43	A	T	6: 91,486,909	I389F	probably benign	Het
Trpm1	A	T	7: 64,223,808	N488Y	probably damaging	Het
Tshz1	A	T	18: 84,013,433	L950Q	probably damaging	Het
Vmn1r16	T	C	6: 57,322,900	I246V	probably benign	Het
Vmn1r188	T	G	13: 22,088,645	S256R	possibly damaging	Het
Zfp12	G	A	5: 143,245,378	E487K	probably damaging	Het

Other mutations in Col4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Col4a3	APN	1	82697754	missense	unknown
IGL00847:Col4a3	APN	1	82717869	missense	probably damaging	1.00
IGL01011:Col4a3	APN	1	82682301	missense	unknown
IGL01102:Col4a3	APN	1	82669720	missense	unknown
IGL01102:Col4a3	APN	1	82670255	missense	unknown
IGL02071:Col4a3	APN	1	82660887	critical splice donor site	probably null
IGL02244:Col4a3	APN	1	82669771	splice site	probably benign
IGL02380:Col4a3	APN	1	82672788	splice site	probably benign
IGL02431:Col4a3	APN	1	82679623	nonsense	probably null
IGL02466:Col4a3	APN	1	82670192	missense	unknown
IGL02694:Col4a3	APN	1	82710794	unclassified	probably benign
IGL02709:Col4a3	APN	1	82679112	missense	unknown
IGL02752:Col4a3	APN	1	82660225	missense	unknown
IGL02792:Col4a3	APN	1	82718803	missense	probably damaging	1.00
IGL03203:Col4a3	APN	1	82672639	nonsense	probably null
IGL03218:Col4a3	APN	1	82643206	splice site	probably benign
FR4976:Col4a3	UTSW	1	82718906	frame shift	probably null
PIT4260001:Col4a3	UTSW	1	82682761	missense	unknown
PIT4515001:Col4a3	UTSW	1	82682303	missense	unknown
R0035:Col4a3	UTSW	1	82672753	missense	unknown
R0099:Col4a3	UTSW	1	82717993	missense	probably benign	0.41
R0433:Col4a3	UTSW	1	82670219	missense	unknown
R0573:Col4a3	UTSW	1	82716363	missense	possibly damaging	0.83
R0606:Col4a3	UTSW	1	82672586	splice site	probably benign
R0715:Col4a3	UTSW	1	82652158	splice site	probably benign
R0961:Col4a3	UTSW	1	82708576	splice site	probably benign
R1257:Col4a3	UTSW	1	82716365	missense	probably damaging	1.00
R1264:Col4a3	UTSW	1	82643301	splice site	probably benign
R1373:Col4a3	UTSW	1	82690087	splice site	probably benign
R1694:Col4a3	UTSW	1	82690663	splice site	probably null
R1925:Col4a3	UTSW	1	82700373	missense	unknown
R1925:Col4a3	UTSW	1	82711874	unclassified	probably benign
R2033:Col4a3	UTSW	1	82718011	intron	probably benign
R2044:Col4a3	UTSW	1	82696319	missense	unknown
R2122:Col4a3	UTSW	1	82654957	missense	unknown
R2282:Col4a3	UTSW	1	82708638	missense	unknown
R2318:Col4a3	UTSW	1	82648569	splice site	probably null
R2421:Col4a3	UTSW	1	82670275	splice site	probably benign
R2517:Col4a3	UTSW	1	82680710	missense	unknown
R2965:Col4a3	UTSW	1	82648600	missense	unknown
R3085:Col4a3	UTSW	1	82651258	missense	unknown
R3150:Col4a3	UTSW	1	82657137	splice site	probably null
R3947:Col4a3	UTSW	1	82715332	missense	probably damaging	1.00
R4756:Col4a3	UTSW	1	82716297	critical splice acceptor site	probably null
R4910:Col4a3	UTSW	1	82672679	missense	unknown
R4928:Col4a3	UTSW	1	82710977	unclassified	probably benign
R5044:Col4a3	UTSW	1	82666546	missense	unknown
R5557:Col4a3	UTSW	1	82715247	unclassified	probably benign
R5761:Col4a3	UTSW	1	82716057	nonsense	probably null
R5970:Col4a3	UTSW	1	82716329	missense	possibly damaging	0.76
R6576:Col4a3	UTSW	1	82708574	splice site	probably null
R6583:Col4a3	UTSW	1	82641476	missense	unknown
R6675:Col4a3	UTSW	1	82668925	missense	unknown
R7170:Col4a3	UTSW	1	82715909	splice site	probably null
R7592:Col4a3	UTSW	1	82648617	missense	unknown
R7624:Col4a3	UTSW	1	82718884	missense	probably benign
R7994:Col4a3	UTSW	1	82662906	missense	unknown
R8127:Col4a3	UTSW	1	82649760	missense	unknown
R8702:Col4a3	UTSW	1	82710979	missense	unknown
R8865:Col4a3	UTSW	1	82669762	critical splice donor site	probably null
R8973:Col4a3	UTSW	1	82715331	missense	probably benign	0.11
X0067:Col4a3	UTSW	1	82716159	missense	probably damaging	0.99
Z1177:Col4a3	UTSW	1	82690039	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATCCTGACGCAACATTAAGCAG -3'
(R):5'- GAGACACAAATGCTTAGAGCCC -3'

Sequencing Primer
(F):5'- CGCAACATTAAGCAGAATTTTGTACC -3'
(R):5'- CCCCTAGAGCACCCACAG -3'

Posted On

2014-06-30