Incidental Mutation 'R5215:Glmn'
ID403405
Institutional Source Beutler Lab
Gene Symbol Glmn
Ensembl Gene ENSMUSG00000029276
Gene Nameglomulin, FKBP associated protein
Synonyms9330160J16Rik, Fap48, Fap68
MMRRC Submission 042788-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5215 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107548967-107597888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107561886 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 351 (C351R)
Ref Sequence ENSEMBL: ENSMUSP00000098509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078021] [ENSMUST00000082121] [ENSMUST00000100949] [ENSMUST00000124546]
Predicted Effect probably benign
Transcript: ENSMUST00000078021
AA Change: C351R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077168
Gene: ENSMUSG00000029276
AA Change: C351R

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 5.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082121
AA Change: C351R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000080766
Gene: ENSMUSG00000029276
AA Change: C351R

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 563 3.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100949
AA Change: C351R

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098509
Gene: ENSMUSG00000029276
AA Change: C351R

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 404 1.1e-63 PFAM
Pfam:Kinetochor_Ybp2 402 499 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124546
SMART Domains Protein: ENSMUSP00000122129
Gene: ENSMUSG00000029276

DomainStartEndE-ValueType
Pfam:Kinetochor_Ybp2 1 95 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphorylated protein that is a member of a Skp1-Cullin-F-box-like complex. The protein is essential for normal development of the vasculature and mutations in this gene have been associated with glomuvenous malformations, also called glomangiomas. Multiple splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete embryonic lethality during organogenesis associated with growth retardation, delayed neural tube closure, incomplete embryo turning, pericardial effusion, disorganized yolk sac vascular plexus and head mesenchyme hypocellularity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 C A 9: 106,243,375 A73S probably benign Het
Aldoart2 G A 12: 55,565,419 R43Q probably benign Het
Ano4 T C 10: 89,317,303 H49R possibly damaging Het
Atic T C 1: 71,564,507 S161P probably damaging Het
Atp6v1c2 T C 12: 17,291,658 E244G probably benign Het
Cd164l2 C A 4: 133,221,478 L42I unknown Het
Cdc42ep2 T C 19: 5,918,210 R156G probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdk5 T A 5: 24,419,461 N265I probably benign Het
Cfap69 G T 5: 5,589,133 N262K possibly damaging Het
Chd6 C T 2: 160,949,953 V2495M probably damaging Het
Cps1 T A 1: 67,166,380 F521I possibly damaging Het
Crb2 A G 2: 37,793,753 E1089G probably benign Het
Decr1 T C 4: 15,929,795 D166G probably damaging Het
Dhodh G A 8: 109,606,343 probably benign Het
Dnaaf5 G A 5: 139,161,877 V399I probably benign Het
Dnah11 T C 12: 118,157,361 T526A probably benign Het
Drosha T C 15: 12,885,133 probably benign Het
Elfn2 T A 15: 78,674,201 I49F probably damaging Het
Gabra1 T C 11: 42,154,828 T152A probably damaging Het
Gigyf2 C A 1: 87,365,266 T85K probably damaging Het
Gimap8 A T 6: 48,651,083 Y258F possibly damaging Het
Gm10032 T C 14: 66,792,549 noncoding transcript Het
Gm340 T C 19: 41,585,932 I1042T probably damaging Het
Gorasp2 G A 2: 70,689,254 A328T probably benign Het
Grin1 A T 2: 25,303,907 H392Q probably benign Het
Gzmn A G 14: 56,167,862 V55A probably damaging Het
Herc4 T A 10: 63,289,097 S497T probably benign Het
Hrc A T 7: 45,336,091 D222V probably damaging Het
Iars2 T C 1: 185,294,769 H761R probably damaging Het
Jmjd1c T A 10: 67,240,701 D2101E possibly damaging Het
Kcng1 C T 2: 168,263,133 M264I probably benign Het
Klra14-ps C A 6: 130,157,683 noncoding transcript Het
Krtap5-3 T A 7: 142,202,237 C270* probably null Het
Lama3 A G 18: 12,577,900 H3164R probably damaging Het
Mdn1 T C 4: 32,741,418 M3840T possibly damaging Het
Mtor A T 4: 148,453,983 H166L probably benign Het
Mx1 T C 16: 97,448,360 N556D possibly damaging Het
Oca2 A T 7: 56,295,498 R285* probably null Het
Olfr103 T A 17: 37,336,813 I140F probably benign Het
Olfr1285 T C 2: 111,409,286 noncoding transcript Het
Olfr521 A G 7: 99,767,510 E116G probably damaging Het
Olfr681 G A 7: 105,126,564 H246Y probably damaging Het
Olfr952 A T 9: 39,426,623 Y149* probably null Het
Pan3 A G 5: 147,455,105 probably null Het
Pard3 G A 8: 127,378,264 V496M probably damaging Het
Pdcd2l A T 7: 34,192,889 V185D possibly damaging Het
Pgghg T C 7: 140,946,564 V623A possibly damaging Het
Pigu C A 2: 155,335,329 probably benign Het
Pkmyt1 G A 17: 23,732,592 R40Q probably benign Het
Prag1 G A 8: 36,099,889 A65T probably benign Het
Prkdc C A 16: 15,772,121 T2616N possibly damaging Het
Prpf8 G A 11: 75,500,204 E1360K probably benign Het
Ptprt C T 2: 162,278,164 V128M probably damaging Het
Rp1l1 C T 14: 64,030,013 S1016L probably benign Het
Rprd1a G T 18: 24,488,200 D307E probably damaging Het
Slc11a1 A T 1: 74,383,777 probably benign Het
Slc22a16 T A 10: 40,581,390 M209K probably damaging Het
Slf2 T G 19: 44,948,037 L707R probably damaging Het
Son T A 16: 91,656,675 M770K probably damaging Het
Taf6l T C 19: 8,778,053 probably benign Het
Tbc1d2 C A 4: 46,614,006 V692L probably benign Het
Tnpo3 C T 6: 29,582,153 probably benign Het
Txndc16 A T 14: 45,211,140 probably benign Het
Ubr1 T C 2: 120,904,044 K1125R probably benign Het
Vmn2r9 A G 5: 108,846,485 S433P probably benign Het
Zc3h12a A G 4: 125,126,913 S46P probably benign Het
Zwilch T G 9: 64,146,874 I490L probably benign Het
Other mutations in Glmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Glmn APN 5 107570139 missense possibly damaging 0.79
IGL00925:Glmn APN 5 107557327 missense probably damaging 1.00
IGL01092:Glmn APN 5 107578512 critical splice acceptor site probably null
IGL02503:Glmn APN 5 107562778 missense probably damaging 0.98
IGL02725:Glmn APN 5 107575289 missense possibly damaging 0.95
IGL03116:Glmn APN 5 107551083 missense probably damaging 1.00
mauna_kea UTSW 5 107593880 critical splice acceptor site probably null
pillow UTSW 5 107549075 missense probably benign 0.20
R0078:Glmn UTSW 5 107557970 missense probably benign 0.31
R0115:Glmn UTSW 5 107560934 missense probably benign 0.00
R0481:Glmn UTSW 5 107560934 missense probably benign 0.00
R1895:Glmn UTSW 5 107570244 missense probably benign 0.34
R1954:Glmn UTSW 5 107572377 missense probably damaging 1.00
R2090:Glmn UTSW 5 107561928 missense probably damaging 1.00
R2132:Glmn UTSW 5 107578455 missense probably damaging 0.98
R3962:Glmn UTSW 5 107561045 intron probably benign
R4296:Glmn UTSW 5 107558502 missense possibly damaging 0.52
R4591:Glmn UTSW 5 107561051 critical splice donor site probably null
R4679:Glmn UTSW 5 107561075 missense probably damaging 1.00
R4992:Glmn UTSW 5 107557301 missense probably damaging 1.00
R5140:Glmn UTSW 5 107570200 missense probably damaging 0.99
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6035:Glmn UTSW 5 107593880 critical splice acceptor site probably null
R6116:Glmn UTSW 5 107557340 missense probably damaging 1.00
R6671:Glmn UTSW 5 107549414 missense probably benign 0.37
R7748:Glmn UTSW 5 107562244 critical splice donor site probably null
R7789:Glmn UTSW 5 107549075 missense probably benign 0.20
R8407:Glmn UTSW 5 107570191 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGAAGTCACAGCAGCACTTAC -3'
(R):5'- CAGAACAGAACAGTCTATTTACTCC -3'

Sequencing Primer
(F):5'- TCACAGCAGCACTTACAGAGGTG -3'
(R):5'- GAAGGAACCAGTTCTCTCCATTG -3'
Posted On2016-07-22