Incidental Mutation 'R1894:Olfr875'
ID211813
Institutional Source Beutler Lab
Gene Symbol Olfr875
Ensembl Gene ENSMUSG00000058628
Gene Nameolfactory receptor 875
SynonymsGA_x6K02T2PVTD-31458511-31459443, MOR161-4
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37771857-37774459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37772867 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 69 (D69E)
Ref Sequence ENSEMBL: ENSMUSP00000150684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080634] [ENSMUST00000215128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080634
AA Change: D69E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079467
Gene: ENSMUSG00000058628
AA Change: D69E

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-48 PFAM
Pfam:7tm_1 40 289 1.8e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215128
AA Change: D69E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Olfr875
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01909:Olfr875 APN 9 37772863 missense possibly damaging 0.95
IGL02013:Olfr875 APN 9 37772889 missense probably benign 0.00
IGL02162:Olfr875 APN 9 37772931 missense probably benign 0.13
IGL02966:Olfr875 APN 9 37773586 missense probably benign 0.28
R0017:Olfr875 UTSW 9 37772978 missense probably benign 0.08
R0520:Olfr875 UTSW 9 37773553 missense probably benign 0.00
R0553:Olfr875 UTSW 9 37773331 missense probably benign 0.05
R0833:Olfr875 UTSW 9 37773076 missense probably benign 0.03
R1316:Olfr875 UTSW 9 37772743 missense possibly damaging 0.94
R1547:Olfr875 UTSW 9 37772664 missense probably benign 0.00
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1891:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R3055:Olfr875 UTSW 9 37773193 missense probably damaging 1.00
R4816:Olfr875 UTSW 9 37773430 missense possibly damaging 0.72
R4829:Olfr875 UTSW 9 37772947 missense probably damaging 1.00
R4952:Olfr875 UTSW 9 37773064 missense probably damaging 0.99
R6111:Olfr875 UTSW 9 37772932 missense probably damaging 0.99
R6838:Olfr875 UTSW 9 37773052 missense possibly damaging 0.87
R7101:Olfr875 UTSW 9 37772991 missense probably damaging 0.99
R7104:Olfr875 UTSW 9 37773141 missense possibly damaging 0.64
R7224:Olfr875 UTSW 9 37773415 missense possibly damaging 0.95
R7334:Olfr875 UTSW 9 37772997 missense probably damaging 0.97
R7582:Olfr875 UTSW 9 37772821 missense probably damaging 1.00
R7909:Olfr875 UTSW 9 37772737 missense probably damaging 1.00
R8498:Olfr875 UTSW 9 37773264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCAAGAATTCCTCTGTGAC -3'
(R):5'- ATGGTGACCGTGTACATCAG -3'

Sequencing Primer
(F):5'- ACAGAGTTCATCCTTGCAGG -3'
(R):5'- CGTGTACATCAGGGGGTTACAGATC -3'
Posted On2014-06-30