Incidental Mutation 'R2030:Snap25'
ID221100
Institutional Source Beutler Lab
Gene Symbol Snap25
Ensembl Gene ENSMUSG00000027273
Gene Namesynaptosomal-associated protein 25
SynonymsBdr, SNAP-25, GENA 70, sp
MMRRC Submission 040037-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location136713453-136782428 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 136770053 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028727] [ENSMUST00000110098]
Predicted Effect probably benign
Transcript: ENSMUST00000028727
SMART Domains Protein: ENSMUSP00000028727
Gene: ENSMUSG00000027273

DomainStartEndE-ValueType
t_SNARE 14 81 1.93e-12 SMART
t_SNARE 135 202 4.93e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110098
SMART Domains Protein: ENSMUSP00000105725
Gene: ENSMUSG00000027273

DomainStartEndE-ValueType
t_SNARE 14 81 9.51e-12 SMART
t_SNARE 135 202 4.93e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small size, blotchy in appearance, have dilated vascular channels, and brain defects, lack spontaneous or reflexive movement and evoked neurotransmitter release at E18.5, and die at birth. An ENU-induced mutant displays neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Atp13a4 A T 16: 29,422,684 V741D probably damaging Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Snap25
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Snap25 UTSW 2 136777464 missense probably damaging 0.99
R1257:Snap25 UTSW 2 136758348 missense probably damaging 1.00
R1547:Snap25 UTSW 2 136777469 missense possibly damaging 0.86
R1880:Snap25 UTSW 2 136777385 missense probably damaging 1.00
R4808:Snap25 UTSW 2 136770102 missense probably damaging 1.00
R6968:Snap25 UTSW 2 136769770 missense probably benign 0.40
R8132:Snap25 UTSW 2 136769828 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTAATCTGTGGCGTCCAG -3'
(R):5'- ATGCCACATGCTCATCCTGC -3'

Sequencing Primer
(F):5'- AATCTGTGGCGTCCAGTTTTC -3'
(R):5'- TGCCTATGAGCCTGCAGGAATG -3'
Posted On2014-08-25