Incidental Mutation 'R2030:Atp13a4'
ID221183
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene NameATPase type 13A4
Synonyms9330174J19Rik, 4631413J11Rik
MMRRC Submission 040037-MU
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2030 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29395853-29544864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29422684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 741 (V741D)
Ref Sequence ENSEMBL: ENSMUSP00000048753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
Predicted Effect probably damaging
Transcript: ENSMUST00000039090
AA Change: V741D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: V741D

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000057018
AA Change: V722D
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: V722D

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182357
Predicted Effect unknown
Transcript: ENSMUST00000182573
AA Change: V379D
Predicted Effect probably damaging
Transcript: ENSMUST00000182627
AA Change: V741D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: V741D

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.7825 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,974,131 Q1155* probably null Het
Adtrp C T 13: 41,828,259 V13I probably damaging Het
Ak2 A G 4: 129,008,220 K229E probably benign Het
Bdp1 A T 13: 100,061,189 M896K probably benign Het
Ccser1 C T 6: 61,311,563 R237C probably benign Het
Cdk7 A G 13: 100,722,674 probably benign Het
CK137956 A G 4: 127,951,387 S188P probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dbndd2 A G 2: 164,488,643 D72G probably damaging Het
Disp3 A T 4: 148,259,966 I493N probably damaging Het
Epx T C 11: 87,864,824 D678G probably damaging Het
Fbxw5 G T 2: 25,504,798 V235L probably damaging Het
Fmo4 T A 1: 162,794,172 D490V probably damaging Het
Fuca2 A G 10: 13,506,774 Y268C probably damaging Het
Gm4787 C T 12: 81,378,770 V205I probably damaging Het
Gpat3 G A 5: 100,897,821 R437K probably benign Het
Herc2 A G 7: 56,184,373 S3109G probably damaging Het
Hr G A 14: 70,571,448 R1117H probably damaging Het
Htra4 T A 8: 25,033,577 D324V probably damaging Het
Kcnd3 A G 3: 105,459,537 Y241C probably damaging Het
Kcp G A 6: 29,489,072 L1072F probably damaging Het
Lrrc52 T C 1: 167,466,459 N86D probably benign Het
Mindy4 A G 6: 55,211,262 T26A probably damaging Het
Mre11a A T 9: 14,795,805 N117Y probably damaging Het
Mrgprb1 A T 7: 48,447,328 S279T possibly damaging Het
Myh13 T G 11: 67,350,238 S814A probably benign Het
Ncapd2 A G 6: 125,176,715 V679A possibly damaging Het
Nipbl A T 15: 8,350,287 V1007D probably damaging Het
Nlrp12 T A 7: 3,228,417 H960L probably damaging Het
Olfr1245 C T 2: 89,575,214 V171I probably benign Het
Olfr402 T A 11: 74,155,943 M263K possibly damaging Het
Olfr860 A G 9: 19,846,413 S69P probably benign Het
Pklr A G 3: 89,143,238 Y402C probably damaging Het
Prdm2 T C 4: 143,132,764 T1319A possibly damaging Het
Rif1 T A 2: 52,092,346 V541E probably damaging Het
Ryk T A 9: 102,881,656 I248N possibly damaging Het
Shisa2 A T 14: 59,629,685 I129F probably damaging Het
Snap25 T G 2: 136,770,053 probably benign Het
Snx31 G A 15: 36,525,702 P284S probably benign Het
Tas2r137 A G 6: 40,492,220 K328R possibly damaging Het
Tas2r140 T C 6: 133,055,250 T182A probably benign Het
Thumpd2 G A 17: 81,064,958 R35C probably damaging Het
Tnxb A T 17: 34,718,469 N3811Y probably damaging Het
Tpte A C 8: 22,345,885 N428T probably damaging Het
Trpm6 A G 19: 18,854,265 D1498G probably benign Het
Tsc2 C T 17: 24,623,470 probably benign Het
Ttn C T 2: 76,872,933 probably benign Het
Wdr24 A G 17: 25,826,043 I251V probably benign Het
Wdr92 A T 11: 17,229,832 T278S probably benign Het
Zc3h6 T C 2: 129,006,086 Y278H probably damaging Het
Zfat A G 15: 68,118,934 probably null Het
Zfp442 A T 2: 150,408,122 V620E possibly damaging Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- CATTGACTTGGGGTTGCCTC -3'
(R):5'- CTGGTCAGGCTGAAACAACC -3'

Sequencing Primer
(F):5'- GGGGTTGCCTCAAAACTTG -3'
(R):5'- AGGCTGAAACAACCTTAGTAATTATC -3'
Posted On2014-08-25