Incidental Mutation 'R2045:Krt7'
ID221880
Institutional Source Beutler Lab
Gene Symbol Krt7
Ensembl Gene ENSMUSG00000023039
Gene Namekeratin 7
SynonymsCytokeratin 7, D15Wsu77e, Krt2-7, K7
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2045 (G1)
Quality Score186
Status Validated
Chromosome15
Chromosomal Location101411043-101430313 bp(+) (GRCm38)
Type of Mutationsplice site (3977 bp from exon)
DNA Base Change (assembly) A to T at 101423484 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068904] [ENSMUST00000147662]
Predicted Effect probably damaging
Transcript: ENSMUST00000068904
AA Change: E394V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069900
Gene: ENSMUSG00000023039
AA Change: E394V

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Pfam:Keratin_2_head 43 81 3.2e-12 PFAM
Filament 84 396 1.95e-174 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131069
Predicted Effect probably null
Transcript: ENSMUST00000147662
SMART Domains Protein: ENSMUSP00000117046
Gene: ENSMUSG00000023039

DomainStartEndE-ValueType
Pfam:Filament 1 115 4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183401
Meta Mutation Damage Score 0.9548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation of urothelial cells without histological evidence of hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Krt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Krt7 APN 15 101427085 unclassified probably benign
IGL01025:Krt7 APN 15 101423421 missense probably benign 0.17
IGL02229:Krt7 APN 15 101427616 missense probably benign 0.09
IGL03366:Krt7 APN 15 101427610 missense possibly damaging 0.87
R0256:Krt7 UTSW 15 101423309 nonsense probably null
R1648:Krt7 UTSW 15 101412567 missense probably damaging 1.00
R1696:Krt7 UTSW 15 101423426 missense probably benign 0.01
R1779:Krt7 UTSW 15 101423409 missense probably damaging 1.00
R1837:Krt7 UTSW 15 101419582 missense probably benign 0.42
R2510:Krt7 UTSW 15 101412657 missense probably benign 0.01
R2511:Krt7 UTSW 15 101412657 missense probably benign 0.01
R4041:Krt7 UTSW 15 101423280 splice site probably null
R4729:Krt7 UTSW 15 101420558 missense probably benign 0.03
R4964:Krt7 UTSW 15 101413972 missense probably damaging 1.00
R5032:Krt7 UTSW 15 101412547 missense probably benign 0.00
R6023:Krt7 UTSW 15 101412397 intron probably benign
R6270:Krt7 UTSW 15 101419558 missense probably damaging 1.00
R7019:Krt7 UTSW 15 101413970 missense probably damaging 1.00
R7645:Krt7 UTSW 15 101412643 missense probably damaging 1.00
R7773:Krt7 UTSW 15 101414032 missense possibly damaging 0.49
R7844:Krt7 UTSW 15 101412634 missense possibly damaging 0.80
X0026:Krt7 UTSW 15 101412772 missense probably damaging 0.98
Z1177:Krt7 UTSW 15 101423467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCAATCAAGGATGCTC -3'
(R):5'- AGGACATTTTCTACAGGGCTAAGAAG -3'

Sequencing Primer
(F):5'- TCAAGGATGCTCATGCTAAGC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2014-08-25