Incidental Mutation 'R2045:Atf2'
ID221766
Institutional Source Beutler Lab
Gene Symbol Atf2
Ensembl Gene ENSMUSG00000027104
Gene Nameactivating transcription factor 2
SynonymsD130078H02Rik, mXBP, Creb2, ATF-2, CRE-BP
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location73816509-73892639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73863208 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3 (D3E)
Ref Sequence ENSEMBL: ENSMUSP00000118357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055833] [ENSMUST00000090802] [ENSMUST00000100009] [ENSMUST00000112007] [ENSMUST00000112010] [ENSMUST00000112016] [ENSMUST00000112017] [ENSMUST00000128531] [ENSMUST00000136958] [ENSMUST00000173010] [ENSMUST00000154456]
Predicted Effect probably damaging
Transcript: ENSMUST00000055833
AA Change: D3E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058521
Gene: ENSMUSG00000027104
AA Change: D3E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090802
SMART Domains Protein: ENSMUSP00000088311
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100009
AA Change: D3E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097588
Gene: ENSMUSG00000027104
AA Change: D3E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112007
SMART Domains Protein: ENSMUSP00000107638
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112010
SMART Domains Protein: ENSMUSP00000107641
Gene: ENSMUSG00000027104

DomainStartEndE-ValueType
low complexity region 197 214 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
BRLZ 292 356 3.15e-21 SMART
low complexity region 397 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112016
AA Change: D3E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107647
Gene: ENSMUSG00000027104
AA Change: D3E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
BRLZ 234 298 3.15e-21 SMART
low complexity region 339 351 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112017
AA Change: D3E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107648
Gene: ENSMUSG00000027104
AA Change: D3E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 396 3.15e-21 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125159
Predicted Effect probably damaging
Transcript: ENSMUST00000128531
AA Change: D3E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118560
Gene: ENSMUSG00000027104
AA Change: D3E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136958
AA Change: D3E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118357
Gene: ENSMUSG00000027104
AA Change: D3E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 139 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141050
Predicted Effect probably damaging
Transcript: ENSMUST00000173010
AA Change: D3E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133632
Gene: ENSMUSG00000027104
AA Change: D3E

DomainStartEndE-ValueType
ZnF_C2H2 7 31 4.4e-2 SMART
low complexity region 237 254 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
BRLZ 332 377 1.32e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143714
Predicted Effect probably benign
Transcript: ENSMUST00000154456
Meta Mutation Damage Score 0.3730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in increased postnatal lethality, skeletal development defects, runting, decreased hearing, inner ear and brain abnormalities, hyperactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Kif21b G A 1: 136,160,313 D1015N probably damaging Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Atf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Atf2 APN 2 73845503 missense possibly damaging 0.85
IGL01608:Atf2 APN 2 73819078 missense probably damaging 1.00
IGL02112:Atf2 APN 2 73819037 missense probably damaging 1.00
IGL02469:Atf2 APN 2 73846332 missense probably damaging 0.99
IGL02686:Atf2 APN 2 73845500 missense possibly damaging 0.90
IGL03381:Atf2 APN 2 73828668 missense probably benign 0.13
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0020:Atf2 UTSW 2 73846284 missense possibly damaging 0.81
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0045:Atf2 UTSW 2 73829856 missense probably benign 0.02
R0480:Atf2 UTSW 2 73819156 splice site probably benign
R0732:Atf2 UTSW 2 73845500 missense possibly damaging 0.90
R1188:Atf2 UTSW 2 73845537 missense probably damaging 0.96
R1285:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1287:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1523:Atf2 UTSW 2 73863208 missense probably damaging 1.00
R1622:Atf2 UTSW 2 73853789 splice site probably null
R1731:Atf2 UTSW 2 73845509 missense probably damaging 1.00
R1935:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1939:Atf2 UTSW 2 73846219 missense probably damaging 1.00
R1965:Atf2 UTSW 2 73850898 missense possibly damaging 0.87
R2000:Atf2 UTSW 2 73863240 critical splice acceptor site probably null
R2256:Atf2 UTSW 2 73845511 splice site probably null
R3147:Atf2 UTSW 2 73850939 splice site probably null
R3890:Atf2 UTSW 2 73863213 missense probably damaging 1.00
R4680:Atf2 UTSW 2 73828681 splice site probably null
R4715:Atf2 UTSW 2 73823300 missense probably damaging 1.00
R5161:Atf2 UTSW 2 73829790 critical splice donor site probably null
R5853:Atf2 UTSW 2 73828469 splice site probably null
R7419:Atf2 UTSW 2 73842433 missense probably benign 0.01
R7833:Atf2 UTSW 2 73853885 missense possibly damaging 0.94
X0033:Atf2 UTSW 2 73846281 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACCACACTGTCTTTTCTAGAACTAG -3'
(R):5'- AGTTCACAGTAAGTTCACAGCTTTC -3'

Sequencing Primer
(F):5'- CACTGTAGTAAAACCTTAATGAC -3'
(R):5'- AAGTTCACAGCTTTCTTACATGGGC -3'
Posted On2014-08-25