Incidental Mutation 'R2045:Kif21b'
ID221760
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission 040052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2045 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136160313 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1015 (D1015N)
Ref Sequence ENSEMBL: ENSMUSP00000114297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864] [ENSMUST00000171381]
Predicted Effect probably damaging
Transcript: ENSMUST00000075164
AA Change: D1015N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: D1015N

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127624
Predicted Effect probably damaging
Transcript: ENSMUST00000130864
AA Change: D1015N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: D1015N

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171381
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 C T 19: 34,243,399 G303E probably damaging Het
Adamts1 A T 16: 85,795,976 Y515N probably damaging Het
Ankef1 T C 2: 136,554,738 V695A probably benign Het
Ankrd63 C A 2: 118,703,353 probably benign Het
Asah2 A T 19: 32,052,956 N105K probably benign Het
Atf2 A C 2: 73,863,208 D3E probably damaging Het
Atp5f1 T C 3: 105,943,874 probably benign Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bms1 A C 6: 118,392,627 L960W probably damaging Het
Cacna1c A G 6: 118,656,137 V977A probably damaging Het
Cadps2 A G 6: 23,839,122 S6P possibly damaging Het
Capn8 A G 1: 182,613,386 T462A probably benign Het
Cd226 T C 18: 89,207,362 S128P probably benign Het
Cd33 G T 7: 43,529,892 H278N probably benign Het
Cdh1 T C 8: 106,666,182 probably benign Het
Cfap54 T C 10: 93,038,809 probably null Het
Chit1 A G 1: 134,151,144 I397M probably benign Het
Cic C A 7: 25,271,536 Q231K possibly damaging Het
Clca4b A G 3: 144,925,163 V312A probably damaging Het
Cngb1 T A 8: 95,297,085 probably null Het
Cyfip2 T C 11: 46,249,789 I430V probably benign Het
Dnah12 A G 14: 26,781,528 E1613G probably null Het
Dock2 T C 11: 34,294,106 probably null Het
Dync2h1 A T 9: 7,160,171 F646I probably damaging Het
Eef1b2 A T 1: 63,179,487 K144* probably null Het
Erap1 T C 13: 74,669,450 V137A probably benign Het
Fam196a T G 7: 134,918,430 K124Q probably damaging Het
Far1 A T 7: 113,539,271 probably null Het
Fbn2 A T 18: 58,090,658 C807S probably damaging Het
Fgfr1 A G 8: 25,558,215 K209R probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem2 A T 3: 53,535,744 V2533D probably damaging Het
Hip1r T C 5: 124,000,731 M839T probably benign Het
Igfbp2 A G 1: 72,852,151 S303G probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb3 T G 11: 104,623,413 S27A probably benign Het
Krt7 A T 15: 101,423,484 probably null Het
Krtdap T A 7: 30,790,585 F80L probably benign Het
Lcp1 A T 14: 75,200,401 T84S probably benign Het
Lipi G A 16: 75,550,199 T444I probably damaging Het
Lrguk A T 6: 34,071,068 E316V probably damaging Het
Lypd1 G A 1: 125,910,535 probably benign Het
Med12l A T 3: 59,262,310 K1632* probably null Het
Mrgpra9 A T 7: 47,235,835 M28K probably benign Het
Mylk A G 16: 34,953,653 K1291E probably benign Het
Nek4 T A 14: 30,953,923 W72R probably damaging Het
Nudt8 T C 19: 4,001,899 V170A probably damaging Het
Oosp3 T A 19: 11,699,369 Y31N probably benign Het
Padi2 A T 4: 140,937,930 R449W probably damaging Het
Pcf11 G T 7: 92,661,879 N300K probably damaging Het
Pcsk5 T C 19: 17,581,144 D633G possibly damaging Het
Phlpp2 T A 8: 109,907,600 W271R probably damaging Het
Pikfyve T C 1: 65,253,353 V1276A probably benign Het
Pkhd1l1 A T 15: 44,479,654 N176Y probably damaging Het
Pop5 T G 5: 115,238,212 V33G possibly damaging Het
Prkag2 A G 5: 24,947,582 F175L possibly damaging Het
Ptpn22 T A 3: 103,874,021 D79E possibly damaging Het
Rab32 T G 10: 10,550,833 D123A probably damaging Het
Rnpc3 T C 3: 113,608,360 K513E possibly damaging Het
Senp1 A T 15: 98,059,944 F358I possibly damaging Het
Sft2d2 A G 1: 165,185,078 L83P probably damaging Het
Slc9c1 G A 16: 45,580,250 R741H probably damaging Het
Smad4 A T 18: 73,649,806 Y352* probably null Het
Tamm41 T A 6: 115,016,095 Q232H probably benign Het
Tbx6 T A 7: 126,782,883 L131Q probably damaging Het
Trappc10 T C 10: 78,209,479 probably benign Het
Trp53bp1 C A 2: 121,204,483 A108S probably benign Het
Unc13b G A 4: 43,091,266 V31M probably damaging Het
Usp24 T C 4: 106,400,980 M1525T possibly damaging Het
Vax2 G A 6: 83,711,270 probably benign Het
Vcan T A 13: 89,690,985 I2147L probably benign Het
Zbtb7a C A 10: 81,144,410 A146E probably benign Het
Zcchc6 T C 13: 59,800,656 Y215C probably damaging Het
Zfp287 A G 11: 62,727,569 L157P probably damaging Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
Schiessen UTSW 1 136147869 critical splice donor site probably null
wolfen UTSW 1 136144758 nonsense probably null
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7156:Kif21b UTSW 1 136147824 missense probably damaging 1.00
R7165:Kif21b UTSW 1 136149448 missense probably damaging 0.98
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
R7975:Kif21b UTSW 1 136171173 missense probably damaging 1.00
RF024:Kif21b UTSW 1 136158341 missense probably damaging 1.00
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Z1176:Kif21b UTSW 1 136154137 missense probably benign 0.00
Z1177:Kif21b UTSW 1 136148312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGTTGGCAGCCAATATTG -3'
(R):5'- GCAGATTCAGTAGCTTGTCCC -3'

Sequencing Primer
(F):5'- GTGTTGGCAGCCAATATTGACTAC -3'
(R):5'- TGTCCCAGCCTGTGAATGAC -3'
Posted On2014-08-25