Incidental Mutation 'R0190:Plcl2'
ID23188
Institutional Source Beutler Lab
Gene Symbol Plcl2
Ensembl Gene ENSMUSG00000038910
Gene Namephospholipase C-like 2
SynonymsPRIP-2, Plce2
MMRRC Submission 038451-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R0190 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location50509547-50688493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50607643 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 560 (D560G)
Ref Sequence ENSEMBL: ENSMUSP00000046584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043938]
Predicted Effect probably benign
Transcript: ENSMUST00000043938
AA Change: D560G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046584
Gene: ENSMUSG00000038910
AA Change: D560G

DomainStartEndE-ValueType
low complexity region 20 49 N/A INTRINSIC
PH 143 254 2.88e-5 SMART
Pfam:EF-hand_like 344 426 3.7e-29 PFAM
PLCXc 427 571 2.19e-84 SMART
PLCYc 619 735 4.37e-61 SMART
C2 756 862 3.45e-19 SMART
Meta Mutation Damage Score 0.3516 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
MGI Phenotype PHENOTYPE: Inactivation of this gene is compatible with normal immune cell development, though the B cell response is dysregulated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,392 probably null Het
Aff2 CA CAAA X: 69,849,105 probably null Het
Ankrd34a A G 3: 96,597,789 D103G probably damaging Het
Atp1b2 T C 11: 69,601,562 D224G probably damaging Het
Atxn10 A G 15: 85,336,529 D22G possibly damaging Het
B230118H07Rik G A 2: 101,586,430 S58L probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Caskin1 C T 17: 24,504,622 L795F possibly damaging Het
Cdk12 T C 11: 98,241,831 probably null Het
Crtc2 A G 3: 90,259,409 H91R probably damaging Het
Dbt A G 3: 116,539,087 probably null Het
Dda1 C A 8: 71,472,233 Y41* probably null Het
Dnah2 T A 11: 69,435,249 D3692V probably damaging Het
Dpep1 A G 8: 123,200,708 T334A probably benign Het
Enthd1 C T 15: 80,534,494 probably null Het
Fpr-rs6 T A 17: 20,182,479 I207F probably benign Het
Fsip2 T A 2: 82,985,177 S3751R possibly damaging Het
Gigyf2 A T 1: 87,428,688 probably benign Het
Gtf3c4 C A 2: 28,840,128 D34Y probably benign Het
Igfn1 A T 1: 135,962,052 V2419E probably damaging Het
Kank1 A T 19: 25,409,283 I79L probably benign Het
Kif21b A G 1: 136,171,219 H1415R probably benign Het
Mad2l1 T C 6: 66,539,878 S185P possibly damaging Het
Mettl18 A G 1: 163,996,422 E104G probably damaging Het
Mrgprb2 G A 7: 48,552,777 H67Y possibly damaging Het
Mrgprd G A 7: 145,321,702 M103I probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Nucks1 A G 1: 131,924,591 D60G probably damaging Het
Olfr1245 T A 2: 89,574,958 Y256F probably damaging Het
Olfr275 G C 4: 52,825,613 W72S probably damaging Het
Olfr978 A G 9: 39,994,544 I245V probably benign Het
Paqr8 A G 1: 20,935,047 T142A probably benign Het
Pdss1 T C 2: 22,906,831 S119P probably damaging Het
Ppm1b T A 17: 84,994,103 V137E probably damaging Het
Ppp1r16b A C 2: 158,696,063 K35Q probably damaging Het
Prkd2 A T 7: 16,869,890 E832V probably damaging Het
Rab34 G T 11: 78,191,406 K191N possibly damaging Het
Rad51ap2 A C 12: 11,458,539 T821P probably benign Het
Rbm19 A G 5: 120,144,046 T823A probably benign Het
Rpf2 T G 10: 40,227,601 H106P probably damaging Het
Schip1 A G 3: 68,625,844 M453V probably benign Het
Sema5a T A 15: 32,562,774 N310K possibly damaging Het
Sf3b1 T C 1: 54,990,306 D1179G probably damaging Het
Skint2 A T 4: 112,616,532 T4S possibly damaging Het
Slc22a5 A T 11: 53,869,415 Y358* probably null Het
Slc34a1 T C 13: 55,409,101 M251T probably benign Het
Slc44a5 A G 3: 154,239,118 D124G probably null Het
Slc9b1 G A 3: 135,357,673 E73K unknown Het
Ssbp2 T C 13: 91,669,710 L156P probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Trim47 A G 11: 116,106,227 V568A probably damaging Het
Ttn A T 2: 76,887,980 probably benign Het
Ttpa A T 4: 20,021,260 I74F probably damaging Het
Vmn2r52 T C 7: 10,171,388 I175V probably benign Het
Wrn C T 8: 33,240,983 C1350Y probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp422 A T 6: 116,626,611 D142E probably damaging Het
Zfp473 A T 7: 44,733,188 C574S probably damaging Het
Zfp638 T A 6: 83,928,964 M37K probably damaging Het
Zfp976 C A 7: 42,642,524 probably benign Het
Other mutations in Plcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Plcl2 APN 17 50606920 missense probably benign 0.01
IGL01746:Plcl2 APN 17 50607696 missense probably benign 0.00
IGL02227:Plcl2 APN 17 50606397 missense probably damaging 0.97
IGL02232:Plcl2 APN 17 50606641 missense possibly damaging 0.66
IGL02878:Plcl2 APN 17 50607355 missense probably damaging 1.00
IGL02985:Plcl2 APN 17 50687814 nonsense probably null
Parece UTSW 17 50607846 missense probably damaging 0.99
verdad UTSW 17 50608081 missense probably damaging 1.00
IGL03014:Plcl2 UTSW 17 50611001 missense possibly damaging 0.65
R0110:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0280:Plcl2 UTSW 17 50607034 missense probably damaging 1.00
R0414:Plcl2 UTSW 17 50607955 missense possibly damaging 0.90
R0450:Plcl2 UTSW 17 50607982 missense probably damaging 1.00
R0760:Plcl2 UTSW 17 50608774 missense possibly damaging 0.82
R1134:Plcl2 UTSW 17 50608110 missense probably benign
R1168:Plcl2 UTSW 17 50607072 missense possibly damaging 0.49
R1381:Plcl2 UTSW 17 50607729 missense probably damaging 0.99
R1748:Plcl2 UTSW 17 50606798 missense probably benign
R1856:Plcl2 UTSW 17 50607850 missense probably benign 0.13
R1958:Plcl2 UTSW 17 50608081 missense probably damaging 1.00
R2016:Plcl2 UTSW 17 50606694 missense probably damaging 1.00
R2057:Plcl2 UTSW 17 50668111 splice site probably null
R2077:Plcl2 UTSW 17 50606829 missense probably benign
R2247:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R3083:Plcl2 UTSW 17 50687744 missense probably benign 0.06
R4153:Plcl2 UTSW 17 50606361 nonsense probably null
R4574:Plcl2 UTSW 17 50607846 missense probably damaging 0.99
R4870:Plcl2 UTSW 17 50607226 missense possibly damaging 0.46
R5030:Plcl2 UTSW 17 50607319 missense possibly damaging 0.92
R5330:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5331:Plcl2 UTSW 17 50509848 missense probably benign 0.01
R5503:Plcl2 UTSW 17 50509929 missense probably benign 0.00
R5920:Plcl2 UTSW 17 50608675 missense probably damaging 0.99
R6238:Plcl2 UTSW 17 50606845 missense probably damaging 0.96
R6378:Plcl2 UTSW 17 50668160 intron probably null
R6603:Plcl2 UTSW 17 50607117 missense probably benign 0.03
R6633:Plcl2 UTSW 17 50640140 missense probably benign 0.00
R7113:Plcl2 UTSW 17 50606464 missense probably damaging 1.00
R7466:Plcl2 UTSW 17 50608468 missense probably damaging 1.00
R7665:Plcl2 UTSW 17 50607157 missense probably benign 0.00
X0026:Plcl2 UTSW 17 50607560 missense probably benign 0.03
Z1088:Plcl2 UTSW 17 50606992 missense probably damaging 1.00
Z1176:Plcl2 UTSW 17 50608456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTTACACAGGCCACACCATGAC -3'
(R):5'- TTGCAAAGCTGAAACCGCTTCAC -3'

Sequencing Primer
(F):5'- AGATAGTCTTCCGCAGCGTC -3'
(R):5'- CTTCACAGGCACATGGTTG -3'
Posted On2013-04-16