Incidental Mutation 'R1443:Phactr4'
ID158636
Institutional Source Beutler Lab
Gene Symbol Phactr4
Ensembl Gene ENSMUSG00000066043
Gene Namephosphatase and actin regulator 4
Synonyms3110001B12Rik, C330013F19Rik
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1443 (G1)
Quality Score182
Status Not validated
Chromosome4
Chromosomal Location132355923-132422489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132377248 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 256 (T256I)
Ref Sequence ENSEMBL: ENSMUSP00000081270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084170] [ENSMUST00000084249] [ENSMUST00000102568] [ENSMUST00000136711] [ENSMUST00000152271]
Predicted Effect probably benign
Transcript: ENSMUST00000084170
AA Change: T219I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081185
Gene: ENSMUSG00000066043
AA Change: T219I

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 488 497 N/A INTRINSIC
Blast:RPEL 511 535 8e-7 BLAST
RPEL 548 573 2.53e-8 SMART
RPEL 586 611 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084249
AA Change: T256I

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081270
Gene: ENSMUSG00000066043
AA Change: T256I

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
RPEL 73 98 1.35e-3 SMART
low complexity region 125 140 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
low complexity region 194 219 N/A INTRINSIC
low complexity region 231 270 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 335 359 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 525 534 N/A INTRINSIC
Blast:RPEL 548 572 9e-7 BLAST
RPEL 585 610 2.53e-8 SMART
RPEL 623 648 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102568
AA Change: T246I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099628
Gene: ENSMUSG00000066043
AA Change: T246I

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
RPEL 63 88 1.35e-3 SMART
low complexity region 115 130 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
low complexity region 184 209 N/A INTRINSIC
low complexity region 221 260 N/A INTRINSIC
low complexity region 281 291 N/A INTRINSIC
low complexity region 325 349 N/A INTRINSIC
low complexity region 498 508 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
Blast:RPEL 538 562 9e-7 BLAST
RPEL 575 600 2.53e-8 SMART
RPEL 613 638 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136711
SMART Domains Protein: ENSMUSP00000122194
Gene: ENSMUSG00000066043

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152271
AA Change: T219I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119767
Gene: ENSMUSG00000066043
AA Change: T219I

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator (PHACTR) family. Other PHACTR family members have been shown to inhibit protein phosphatase 1 (PP1) activity, and the homolog of this gene in the mouse has been shown to interact with actin and PP1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality, exencephaly, neural tube defects, coloboma, and altered cell cycles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Phactr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Phactr4 APN 4 132370992 missense possibly damaging 0.94
IGL01106:Phactr4 APN 4 132370805 missense probably benign 0.09
IGL01962:Phactr4 APN 4 132363775 missense probably damaging 0.99
IGL02382:Phactr4 APN 4 132370841 missense probably damaging 1.00
IGL02466:Phactr4 APN 4 132377172 splice site probably benign
IGL02891:Phactr4 APN 4 132387023 missense probably damaging 1.00
P0027:Phactr4 UTSW 4 132371090 missense probably damaging 1.00
R0317:Phactr4 UTSW 4 132386930 missense probably damaging 1.00
R0961:Phactr4 UTSW 4 132378420 missense probably benign
R1435:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1441:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1960:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1961:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R2145:Phactr4 UTSW 4 132370784 missense probably damaging 0.98
R3077:Phactr4 UTSW 4 132397996 start codon destroyed probably null 0.53
R3423:Phactr4 UTSW 4 132369747 missense probably benign 0.38
R3782:Phactr4 UTSW 4 132367867 splice site probably null
R3871:Phactr4 UTSW 4 132377249 missense probably benign 0.00
R4427:Phactr4 UTSW 4 132387041 missense possibly damaging 0.90
R4672:Phactr4 UTSW 4 132370706 missense probably damaging 1.00
R4871:Phactr4 UTSW 4 132378448 missense probably damaging 1.00
R5264:Phactr4 UTSW 4 132370982 missense probably damaging 0.99
R5558:Phactr4 UTSW 4 132378455 missense probably damaging 1.00
R5955:Phactr4 UTSW 4 132386909 missense probably damaging 1.00
R6953:Phactr4 UTSW 4 132377351 missense possibly damaging 0.66
R7210:Phactr4 UTSW 4 132358271 makesense probably null
R7286:Phactr4 UTSW 4 132377178 critical splice donor site probably null
R7823:Phactr4 UTSW 4 132361619 nonsense probably null
R7826:Phactr4 UTSW 4 132378441 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- tgcttgcttgcttTCTCAGTgaca -3'
(R):5'- TGGCTCTACCACCGTGACATCT -3'

Sequencing Primer
(F):5'- cgggagacagaggcagg -3'
(R):5'- ACCGTGACATCTGCTGC -3'
Posted On2014-03-14