Mutagenetix > Incidental Mutations

Incidental Mutation 'R2162:Ppp1r9b'

235222

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r9b

Ensembl Gene

ENSMUSG00000038976

Gene Name

protein phosphatase 1, regulatory subunit 9B

Synonyms

SPL, Spn, spinophilin, neurabin II

MMRRC Submission

040165-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2162 (G1)

Quality Score

184

Status

Validated

Chromosome

Chromosomal Location

94991035-95006899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94998051 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 97 (L97P)

Ref Sequence

ENSEMBL: ENSMUSP00000103377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038696] [ENSMUST00000107748]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038696
AA Change: L521P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041732
Gene: ENSMUSG00000038976
AA Change: L521P

Domain	Start	End	E-Value	Type
low complexity region	64	83	N/A	INTRINSIC
low complexity region	126	142	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
low complexity region	253	260	N/A	INTRINSIC
low complexity region	281	317	N/A	INTRINSIC
low complexity region	332	361	N/A	INTRINSIC
low complexity region	399	430	N/A	INTRINSIC
Blast:PDZ	431	458	4e-10	BLAST
PDZ	504	584	7.03e-19	SMART
low complexity region	600	612	N/A	INTRINSIC
Blast:PDZ	731	768	2e-10	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000107748
AA Change: L97P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103377
Gene: ENSMUSG00000038976
AA Change: L97P

Domain	Start	End	E-Value	Type
PDZ	80	160	7.03e-19	SMART
low complexity region	176	188	N/A	INTRINSIC
Blast:PDZ	307	344	4e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151771

Meta Mutation Damage Score

0.1771

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions as a regulatory subunit of protein phosphatase 1a. Expression of this gene is particularly high in dendritic spines, suggesting that the encoded protein may play a role in receiving signals from the central nervous system. The encoded protein has putative tumor suppressor function and decreased expression has been observed in tumors. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal glutamatergic synaptic transmission, reduced long-term depression, resistance to kainate-induced seizures, impaired taste aversion learning, and increased dendritic spine density. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,238	T524A	possibly damaging	Het
Adamts20	A	C	15: 94,331,458	C927G	probably damaging	Het
Afdn	T	A	17: 13,896,174	D190E	probably benign	Het
Ankrd28	T	C	14: 31,708,762	D850G	probably damaging	Het
Arhgap45	T	C	10: 80,016,979	M1T	probably null	Het
Atp6v0a4	T	G	6: 38,088,646	K128N	possibly damaging	Het
Bcat1	T	A	6: 145,010,108	D349V	probably damaging	Het
Cacna1i	T	C	15: 80,356,187	F370S	probably damaging	Het
Clca4b	T	C	3: 144,928,587	I82V	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dnaaf5	T	C	5: 139,181,565	V447A	possibly damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Eng	C	T	2: 32,679,047	R528C	probably damaging	Het
Gcn1l1	A	T	5: 115,592,132	Q835L	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Hlx	T	A	1: 184,730,692		probably null	Het
Htt	T	A	5: 34,821,718	V815D	probably benign	Het
Il1f5	G	T	2: 24,279,680	L17F	probably damaging	Het
Itga1	C	T	13: 115,030,910	V157I	probably benign	Het
Krtap19-3	T	G	16: 88,877,719	*88C	probably null	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mep1b	C	T	18: 21,086,239	T150I	possibly damaging	Het
Mroh7	G	C	4: 106,700,181	S777R	probably damaging	Het
Nrxn1	G	A	17: 90,162,431	R35C	probably damaging	Het
Olfr1145	T	A	2: 87,810,360	I180K	probably damaging	Het
Olfr494	C	A	7: 108,367,562	P24Q	probably benign	Het
Olfr624	T	G	7: 103,670,872	Q53P	possibly damaging	Het
Pacs2	A	G	12: 113,050,947	T243A	probably benign	Het
Pan2	A	G	10: 128,304,222	E4G	possibly damaging	Het
Pdp1	A	G	4: 11,961,123	V396A	probably damaging	Het
Pdzd7	A	G	19: 45,036,055		probably null	Het
Peg10	T	A	6: 4,755,914		probably benign	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Piezo2	A	G	18: 63,081,662		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scn9a	T	A	2: 66,534,229	Y789F	probably damaging	Het
Slit3	A	T	11: 35,688,682	S1229C	probably null	Het
Sptan1	T	C	2: 30,018,576		probably benign	Het
Srrd	G	T	5: 112,342,944		probably benign	Het
Tdrd3	A	G	14: 87,480,785	T201A	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttll4	A	G	1: 74,686,391	K653E	probably damaging	Het
Usp43	A	G	11: 67,879,969	L613P	probably damaging	Het
Vmn1r167	T	C	7: 23,504,799	D264G	possibly damaging	Het
Whamm	A	G	7: 81,571,341	D7G	probably damaging	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp280d	T	A	9: 72,298,822	I62K	probably damaging	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zfp516	A	G	18: 82,986,938	R656G	possibly damaging	Het

Other mutations in Ppp1r9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01714:Ppp1r9b	APN	11	95005354	missense	probably damaging	0.96
IGL02261:Ppp1r9b	APN	11	95002110	missense	probably damaging	1.00
R0068:Ppp1r9b	UTSW	11	95001220	missense	probably damaging	1.00
R0719:Ppp1r9b	UTSW	11	95001835	splice site	probably null
R1185:Ppp1r9b	UTSW	11	95001986	missense	possibly damaging	0.95
R1185:Ppp1r9b	UTSW	11	95001986	missense	possibly damaging	0.95
R1185:Ppp1r9b	UTSW	11	95001986	missense	possibly damaging	0.95
R1385:Ppp1r9b	UTSW	11	94992211	missense	probably benign	0.06
R1639:Ppp1r9b	UTSW	11	94996610	missense	probably damaging	1.00
R1642:Ppp1r9b	UTSW	11	95001324	synonymous	silent
R2000:Ppp1r9b	UTSW	11	94996620	missense	probably damaging	1.00
R2332:Ppp1r9b	UTSW	11	94996609	missense	probably damaging	0.96
R3815:Ppp1r9b	UTSW	11	94992533	missense	probably damaging	1.00
R4426:Ppp1r9b	UTSW	11	95001324	missense	possibly damaging	0.93
R4427:Ppp1r9b	UTSW	11	95001324	missense	possibly damaging	0.93
R5121:Ppp1r9b	UTSW	11	94996653	missense	probably damaging	0.99
R5205:Ppp1r9b	UTSW	11	95001298	missense	probably benign	0.11
R5348:Ppp1r9b	UTSW	11	94996612	nonsense	probably null
R5397:Ppp1r9b	UTSW	11	95002110	missense	probably damaging	1.00
R5399:Ppp1r9b	UTSW	11	94992148	missense	probably benign
R6188:Ppp1r9b	UTSW	11	94991836	missense	probably damaging	0.99
R6860:Ppp1r9b	UTSW	11	94992148	missense	probably benign
R7308:Ppp1r9b	UTSW	11	95004571	missense	possibly damaging	0.86
R7357:Ppp1r9b	UTSW	11	95004598	missense	probably benign	0.00
R7479:Ppp1r9b	UTSW	11	94992032	missense	possibly damaging	0.85
R7587:Ppp1r9b	UTSW	11	95001940	missense	possibly damaging	0.65
R7651:Ppp1r9b	UTSW	11	95001942	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGTCAGCTCGTTGGATAGG -3'
(R):5'- TGCTCCGTGAACATCCGAAG -3'

Sequencing Primer
(F):5'- AACCCGTATGAGTTAGCCTG -3'
(R):5'- TCCGTGAACATCCGAAGACACAC -3'

Posted On

2014-10-01