Incidental Mutation 'R5397:Ppp1r9b'
ID429761
Institutional Source Beutler Lab
Gene Symbol Ppp1r9b
Ensembl Gene ENSMUSG00000038976
Gene Nameprotein phosphatase 1, regulatory subunit 9B
SynonymsSPL, Spn, spinophilin, neurabin II
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5397 (G1)
Quality Score202
Status Not validated
Chromosome11
Chromosomal Location94991035-95006899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95002110 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 260 (E260G)
Ref Sequence ENSEMBL: ENSMUSP00000103377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038696] [ENSMUST00000107748]
Predicted Effect probably damaging
Transcript: ENSMUST00000038696
AA Change: E684G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041732
Gene: ENSMUSG00000038976
AA Change: E684G

DomainStartEndE-ValueType
low complexity region 64 83 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 253 260 N/A INTRINSIC
low complexity region 281 317 N/A INTRINSIC
low complexity region 332 361 N/A INTRINSIC
low complexity region 399 430 N/A INTRINSIC
Blast:PDZ 431 458 4e-10 BLAST
PDZ 504 584 7.03e-19 SMART
low complexity region 600 612 N/A INTRINSIC
Blast:PDZ 731 768 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107748
AA Change: E260G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103377
Gene: ENSMUSG00000038976
AA Change: E260G

DomainStartEndE-ValueType
PDZ 80 160 7.03e-19 SMART
low complexity region 176 188 N/A INTRINSIC
Blast:PDZ 307 344 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151771
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions as a regulatory subunit of protein phosphatase 1a. Expression of this gene is particularly high in dendritic spines, suggesting that the encoded protein may play a role in receiving signals from the central nervous system. The encoded protein has putative tumor suppressor function and decreased expression has been observed in tumors. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal glutamatergic synaptic transmission, reduced long-term depression, resistance to kainate-induced seizures, impaired taste aversion learning, and increased dendritic spine density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Ppp1r9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Ppp1r9b APN 11 95005354 missense probably damaging 0.96
IGL02261:Ppp1r9b APN 11 95002110 missense probably damaging 1.00
R0068:Ppp1r9b UTSW 11 95001220 missense probably damaging 1.00
R0719:Ppp1r9b UTSW 11 95001835 splice site probably null
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1185:Ppp1r9b UTSW 11 95001986 missense possibly damaging 0.95
R1385:Ppp1r9b UTSW 11 94992211 missense probably benign 0.06
R1639:Ppp1r9b UTSW 11 94996610 missense probably damaging 1.00
R1642:Ppp1r9b UTSW 11 95001324 synonymous silent
R2000:Ppp1r9b UTSW 11 94996620 missense probably damaging 1.00
R2162:Ppp1r9b UTSW 11 94998051 missense probably damaging 1.00
R2332:Ppp1r9b UTSW 11 94996609 missense probably damaging 0.96
R3815:Ppp1r9b UTSW 11 94992533 missense probably damaging 1.00
R4426:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R4427:Ppp1r9b UTSW 11 95001324 missense possibly damaging 0.93
R5121:Ppp1r9b UTSW 11 94996653 missense probably damaging 0.99
R5205:Ppp1r9b UTSW 11 95001298 missense probably benign 0.11
R5348:Ppp1r9b UTSW 11 94996612 nonsense probably null
R5399:Ppp1r9b UTSW 11 94992148 missense probably benign
R6188:Ppp1r9b UTSW 11 94991836 missense probably damaging 0.99
R6860:Ppp1r9b UTSW 11 94992148 missense probably benign
R7308:Ppp1r9b UTSW 11 95004571 missense possibly damaging 0.86
R7357:Ppp1r9b UTSW 11 95004598 missense probably benign 0.00
R7479:Ppp1r9b UTSW 11 94992032 missense possibly damaging 0.85
R7587:Ppp1r9b UTSW 11 95001940 missense possibly damaging 0.65
R7651:Ppp1r9b UTSW 11 95001942 missense probably benign 0.03
R7871:Ppp1r9b UTSW 11 95001909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAATGGCCATTGAGGTG -3'
(R):5'- AGAGCTCTTGGGCCCTTAATC -3'

Sequencing Primer
(F):5'- CCATTGAGGTGTTTGAACTAGCAGAG -3'
(R):5'- AATCCTGATATCCCTGGTCTCACAG -3'
Posted On2016-09-06