Incidental Mutation 'R2141:Tonsl'
ID236294
Institutional Source Beutler Lab
Gene Symbol Tonsl
Ensembl Gene ENSMUSG00000059323
Gene Nametonsoku-like, DNA repair protein
SynonymsNfkbil2, 2810439M11Rik
MMRRC Submission 040144-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2141 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76626002-76639958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76632661 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 923 (I923N)
Ref Sequence ENSEMBL: ENSMUSP00000129597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165190] [ENSMUST00000168185]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163990
Predicted Effect probably benign
Transcript: ENSMUST00000165163
SMART Domains Protein: ENSMUSP00000131229
Gene: ENSMUSG00000059323

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165190
SMART Domains Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 4e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
low complexity region 259 271 N/A INTRINSIC
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168185
AA Change: I923N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: I923N

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 7e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
Pfam:TPR_8 242 274 8.7e-3 PFAM
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
low complexity region 413 437 N/A INTRINSIC
low complexity region 465 494 N/A INTRINSIC
low complexity region 500 511 N/A INTRINSIC
ANK 528 559 8.36e1 SMART
ANK 561 590 4.85e-8 SMART
ANK 597 626 2.85e-5 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
LRR 1058 1085 2.86e-1 SMART
LRR 1086 1113 5.88e-1 SMART
LRR 1117 1144 1.67e-2 SMART
LRR 1177 1204 2.72e0 SMART
LRR 1236 1263 7.02e0 SMART
LRR 1264 1292 1.46e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171478
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik G T 11: 58,423,926 C150F probably damaging Het
4932431P20Rik T C 7: 29,531,510 noncoding transcript Het
Aagab T A 9: 63,616,675 probably null Het
Abca15 A C 7: 120,407,474 T1654P probably damaging Het
Abca17 T A 17: 24,334,266 Y157F probably benign Het
Aftph A T 11: 20,698,318 L813* probably null Het
Agap1 T C 1: 89,837,755 I615T probably damaging Het
Ak3 T G 19: 29,022,847 Q221H probably benign Het
Aldoa A G 7: 126,797,642 probably null Het
Anxa8 T C 14: 34,091,916 probably null Het
Baz2a A G 10: 128,123,612 D1329G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep70 A G 9: 99,296,385 Y512C probably damaging Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Diablo A G 5: 123,523,361 V24A probably benign Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Esco1 A G 18: 10,574,873 probably null Het
Fam173b T C 15: 31,609,572 F146L probably benign Het
Fam26f G T 10: 34,127,695 A72E probably damaging Het
Fancd2 A G 6: 113,549,321 N335S probably benign Het
Flnc A G 6: 29,448,675 Y1304C probably damaging Het
Fubp3 A G 2: 31,600,557 probably benign Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gjc3 A C 5: 137,957,546 L159R probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm21957 G T 7: 125,219,453 noncoding transcript Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5885 A G 6: 133,529,275 noncoding transcript Het
Gm8989 T A 7: 106,329,956 T245S probably damaging Het
Gon4l A T 3: 88,887,595 T402S possibly damaging Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Impdh2 A G 9: 108,565,347 E305G possibly damaging Het
Ints7 T A 1: 191,604,860 C351S possibly damaging Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Kcnq3 T C 15: 65,995,851 M648V probably benign Het
Kctd16 A G 18: 40,259,178 E273G possibly damaging Het
Kif18a T A 2: 109,333,503 N732K probably benign Het
Kif21b C T 1: 136,152,264 R513W probably damaging Het
Klhl36 T C 8: 119,876,772 C589R possibly damaging Het
Lck A G 4: 129,548,920 Y481H probably damaging Het
Lmtk2 A G 5: 144,147,615 Y156C probably damaging Het
Mical3 A T 6: 121,031,134 probably null Het
Mki67 A G 7: 135,695,592 I2571T possibly damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myo10 A G 15: 25,714,108 E87G probably benign Het
Myo18b T C 5: 112,874,026 K500R probably benign Het
N4bp2l2 A T 5: 150,647,536 I458N probably damaging Het
Nat10 T C 2: 103,731,303 probably null Het
Nfasc G A 1: 132,596,645 P932L probably damaging Het
Nipa1 C A 7: 55,997,511 probably null Het
Nkpd1 A G 7: 19,524,237 Q647R probably damaging Het
Nlrc4 T A 17: 74,447,951 probably benign Het
Nmbr C A 10: 14,770,442 Y353* probably null Het
Nos1ap T A 1: 170,329,166 D241V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1025-ps1 A G 2: 85,918,827 I301V probably null Het
Olfr1173 A G 2: 88,275,010 V13A probably benign Het
Olfr1289 A T 2: 111,483,630 T95S probably benign Het
Olfr770 A G 10: 129,133,006 I254T probably benign Het
Optc A T 1: 133,903,796 probably null Het
Pank1 G A 19: 34,878,980 R33C possibly damaging Het
Pcmtd1 C T 1: 7,169,565 R77C probably damaging Het
Phkg2 G A 7: 127,582,214 probably null Het
Plcb4 G A 2: 135,976,099 V762M probably damaging Het
Pramel7 T A 2: 87,489,977 H324L probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Rai1 C A 11: 60,189,467 S1452R possibly damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rufy2 G T 10: 62,990,994 R104L probably damaging Het
Senp6 T A 9: 80,123,820 N8K probably damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Sipa1l2 G A 8: 125,491,491 P369L probably benign Het
Slc43a1 T C 2: 84,840,961 L37P probably damaging Het
Slf1 T A 13: 77,049,219 probably null Het
Ssr2 T A 3: 88,576,642 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tas2r115 T C 6: 132,737,358 K210R probably benign Het
Tbx18 A G 9: 87,715,653 V276A probably damaging Het
Tie1 G A 4: 118,472,811 R1072* probably null Het
Tm2d2 C A 8: 25,022,658 T174K probably damaging Het
Tmem98 A G 11: 80,814,332 D82G possibly damaging Het
Tmub2 A G 11: 102,287,553 E94G possibly damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttc21a G A 9: 119,964,295 V977M probably damaging Het
Ube2ql1 T C 13: 69,738,664 D226G probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Zadh2 T C 18: 84,094,543 Y115H probably benign Het
Zfp408 A G 2: 91,647,849 probably benign Het
Zfp473 T C 7: 44,733,077 T610A possibly damaging Het
Zfp804b A G 5: 6,772,583 V160A probably benign Het
Zfp960 A G 17: 17,087,884 T287A probably benign Het
Other mutations in Tonsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tonsl APN 15 76638496 missense possibly damaging 0.78
IGL00763:Tonsl APN 15 76633868 missense probably damaging 1.00
IGL00796:Tonsl APN 15 76625149 missense probably benign
IGL00965:Tonsl APN 15 76631880 splice site probably benign
IGL01434:Tonsl APN 15 76631102 missense probably benign 0.11
IGL01859:Tonsl APN 15 76634780 missense probably damaging 0.97
IGL02112:Tonsl APN 15 76633402 missense probably benign 0.01
IGL02189:Tonsl APN 15 76623178 missense possibly damaging 0.56
IGL02281:Tonsl APN 15 76634074 missense probably damaging 1.00
IGL02627:Tonsl APN 15 76634095 missense probably damaging 0.99
IGL02750:Tonsl APN 15 76633389 missense probably damaging 0.97
IGL02977:Tonsl APN 15 76632873 missense probably benign 0.00
R0127:Tonsl UTSW 15 76633485 missense probably benign 0.01
R0316:Tonsl UTSW 15 76629300 missense possibly damaging 0.68
R0443:Tonsl UTSW 15 76639684 missense probably benign
R0714:Tonsl UTSW 15 76633721 splice site probably benign
R0946:Tonsl UTSW 15 76623221 missense probably benign 0.03
R0975:Tonsl UTSW 15 76638932 missense probably damaging 0.99
R1263:Tonsl UTSW 15 76622562 missense possibly damaging 0.85
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1610:Tonsl UTSW 15 76638557 missense probably damaging 1.00
R1623:Tonsl UTSW 15 76638509 missense probably damaging 1.00
R1763:Tonsl UTSW 15 76638066 missense probably damaging 1.00
R1882:Tonsl UTSW 15 76624150 missense possibly damaging 0.83
R1898:Tonsl UTSW 15 76638853 unclassified probably null
R1932:Tonsl UTSW 15 76624597 missense probably damaging 0.97
R2166:Tonsl UTSW 15 76637313 missense probably benign 0.13
R2191:Tonsl UTSW 15 76632680 missense probably damaging 0.96
R2198:Tonsl UTSW 15 76636672 missense probably benign 0.00
R2219:Tonsl UTSW 15 76634640 missense probably damaging 1.00
R2762:Tonsl UTSW 15 76630620 missense probably damaging 1.00
R3156:Tonsl UTSW 15 76639521 missense probably damaging 1.00
R3508:Tonsl UTSW 15 76639756 missense probably benign
R4012:Tonsl UTSW 15 76637044 missense probably damaging 1.00
R4179:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4180:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4327:Tonsl UTSW 15 76639716 missense probably benign
R4627:Tonsl UTSW 15 76637224 missense probably damaging 1.00
R4671:Tonsl UTSW 15 76623410 missense probably benign 0.01
R4825:Tonsl UTSW 15 76633248 missense probably benign 0.34
R4840:Tonsl UTSW 15 76633209 missense probably benign
R5030:Tonsl UTSW 15 76638101 missense probably damaging 1.00
R5143:Tonsl UTSW 15 76636657 missense possibly damaging 0.80
R6238:Tonsl UTSW 15 76636218 unclassified probably null
R6379:Tonsl UTSW 15 76629742 missense probably benign
R6401:Tonsl UTSW 15 76633666 missense probably damaging 1.00
R6534:Tonsl UTSW 15 76629677 missense probably damaging 1.00
R6695:Tonsl UTSW 15 76629818 missense possibly damaging 0.84
R6701:Tonsl UTSW 15 76629300 missense probably damaging 1.00
R7138:Tonsl UTSW 15 76634776 missense probably benign
R7206:Tonsl UTSW 15 76633651 missense probably damaging 1.00
R7287:Tonsl UTSW 15 76633725 intron probably null
R7615:Tonsl UTSW 15 76630607 missense probably benign 0.44
R7626:Tonsl UTSW 15 76633936 missense probably null 1.00
R7641:Tonsl UTSW 15 76633652 missense probably damaging 1.00
R8311:Tonsl UTSW 15 76633263 missense probably benign
Z1177:Tonsl UTSW 15 76636153 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGCAGAGTGCCAAGTCCAAG -3'
(R):5'- ATGGCAGCTTGAATGCAGAG -3'

Sequencing Primer
(F):5'- AAGTCCAAGGGAGTCCTGCTC -3'
(R):5'- TGCAGAGAACCCCAGCGTG -3'
Posted On2014-10-01