Mutagenetix > Incidental Mutations

Incidental Mutation 'R4627:Tonsl'

348906

Institutional Source

Beutler Lab

Gene Symbol

Tonsl

Ensembl Gene

ENSMUSG00000059323

Gene Name

tonsoku-like, DNA repair protein

Synonyms

Nfkbil2, 2810439M11Rik

MMRRC Submission

041892-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76626002-76639958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 76637224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 323 (K323Q)

Ref Sequence

ENSEMBL: ENSMUSP00000129597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165190] [ENSMUST00000166974] [ENSMUST00000168185]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163161

Predicted Effect

probably damaging
Transcript: ENSMUST00000165190
AA Change: K323Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323
AA Change: K323Q

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	4e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
low complexity region	259	271	N/A	INTRINSIC
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166974

Predicted Effect

probably damaging
Transcript: ENSMUST00000168185
AA Change: K323Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: K323Q

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	7e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
Pfam:TPR_8	242	274	8.7e-3	PFAM
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART
low complexity region	413	437	N/A	INTRINSIC
low complexity region	465	494	N/A	INTRINSIC
low complexity region	500	511	N/A	INTRINSIC
ANK	528	559	8.36e1	SMART
ANK	561	590	4.85e-8	SMART
ANK	597	626	2.85e-5	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	729	753	N/A	INTRINSIC
low complexity region	1031	1044	N/A	INTRINSIC
LRR	1058	1085	2.86e-1	SMART
LRR	1086	1113	5.88e-1	SMART
LRR	1117	1144	1.67e-2	SMART
LRR	1177	1204	2.72e0	SMART
LRR	1236	1263	7.02e0	SMART
LRR	1264	1292	1.46e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171478

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
Adam6a	A	T	12: 113,544,949	D314V	probably benign	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adamtsl2	T	A	2: 27,093,585	L331Q	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Aldoart1	T	C	4: 72,852,443	T43A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ano7	T	C	1: 93,375,185	I15T	probably benign	Het
Aox3	A	T	1: 58,125,035	T155S	probably damaging	Het
Ap2a1	C	T	7: 44,904,419	V535M	probably damaging	Het
Apbb2	C	T	5: 66,400,076		probably null	Het
Astn1	C	A	1: 158,502,251	H225Q	possibly damaging	Het
Atm	A	G	9: 53,456,506	I2439T	possibly damaging	Het
Atp1b2	T	A	11: 69,601,334	I263F	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Cep192	C	G	18: 67,812,369	P180R	probably benign	Het
Cfap46	T	C	7: 139,657,281	Y571C	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chchd6	G	A	6: 89,384,660	L226F	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cobl	T	C	11: 12,251,093	E1214G	probably damaging	Het
Cpsf2	G	A	12: 101,989,895	R319Q	probably benign	Het
Csdc2	T	C	15: 81,949,123	V107A	probably benign	Het
Csmd1	A	G	8: 16,697,917	W273R	probably benign	Het
Diexf	T	C	1: 193,107,695	T719A	probably benign	Het
Dnah2	T	A	11: 69,465,376	N2156I	probably damaging	Het
Dsp	A	G	13: 38,168,641	Y165C	probably benign	Het
Exoc1	T	C	5: 76,542,228	V205A	probably benign	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fbln2	G	T	6: 91,259,767	V755L	probably damaging	Het
Fhad1	A	T	4: 141,896,468	V1371D	possibly damaging	Het
Folh1	A	T	7: 86,773,252	M59K	probably benign	Het
Foxf2	A	T	13: 31,626,888	H270L	probably benign	Het
Gm14401	G	A	2: 177,086,316	R65H	probably benign	Het
Gpn1	C	A	5: 31,498,393	Y592*	probably null	Het
Hmcn1	T	G	1: 150,595,894	D4903A	probably benign	Het
Hnf1a	T	C	5: 114,955,871	R220G	probably damaging	Het
Hoxd10	G	A	2: 74,692,292	A105T	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	C	T	12: 25,057,042	T1498I	possibly damaging	Het
Klhl2	G	T	8: 64,758,191	Y274*	probably null	Het
Lmbrd1	A	G	1: 24,705,999	Y140C	probably damaging	Het
Mapk8ip3	G	A	17: 24,903,293	T706I	probably benign	Het
Mast4	A	C	13: 103,334,021	S58A	possibly damaging	Het
Mcm6	T	C	1: 128,351,548	D167G	probably benign	Het
Mmachc	A	T	4: 116,703,471	S276T	probably damaging	Het
Nfat5	A	T	8: 107,369,276	Q1289L	probably damaging	Het
Nlrc4	G	T	17: 74,446,628	F253L	probably damaging	Het
Nr1i3	C	A	1: 171,216,445	A112E	probably benign	Het
Olfr1367	T	C	13: 21,347,464	F179L	probably damaging	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr455	T	A	6: 42,538,441	T194S	possibly damaging	Het
Olfr853	G	T	9: 19,537,673	Q86K	possibly damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pde10a	A	C	17: 8,981,652	D779A	probably damaging	Het
Pde4b	T	C	4: 102,601,605	L486S	probably damaging	Het
Pex2	A	T	3: 5,561,281	I156N	probably damaging	Het
Phtf2	C	T	5: 20,773,740	R63Q	probably damaging	Het
Prag1	A	G	8: 36,103,292	Y343C	probably damaging	Het
Prdm16	A	T	4: 154,367,240	Y170N	probably damaging	Het
Prpf6	A	C	2: 181,601,474	K5T	probably damaging	Het
Ptpn1	A	G	2: 167,967,781	K103R	probably benign	Het
Ralgapa2	A	G	2: 146,361,453	S1159P	possibly damaging	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Ripk4	A	T	16: 97,744,026	S474T	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Sec16a	A	G	2: 26,429,393	V1491A	probably damaging	Het
Sec16a	C	T	2: 26,431,068		probably null	Het
Setd7	G	T	3: 51,542,665	N113K	probably damaging	Het
Shank2	C	T	7: 144,411,424	T1502M	probably damaging	Het
Skor1	A	T	9: 63,145,476	C376S	probably damaging	Het
Slc12a3	A	T	8: 94,329,384	L49F	probably benign	Het
Slc35d3	C	T	10: 19,849,331	V260M	probably damaging	Het
Slc46a1	T	A	11: 78,466,889	V256E	probably benign	Het
Slc6a1	T	C	6: 114,308,106	S127P	probably benign	Het
Syngr4	A	G	7: 45,887,028	L190P	probably damaging	Het
Tagap	G	A	17: 7,926,941		probably null	Het
Tamm41	A	T	6: 115,035,002	N89K	probably benign	Het
Tbc1d31	T	A	15: 57,967,912	M922K	probably benign	Het
Tbk1	T	C	10: 121,568,080	N254S	possibly damaging	Het
Tfec	A	G	6: 16,840,479	S140P	probably damaging	Het
Tnrc18	T	C	5: 142,740,128	E1802G	unknown	Het
Tom1l2	C	T	11: 60,242,707		probably null	Het
Tsnaxip1	A	T	8: 105,841,407	E268D	probably damaging	Het
Ttf1	C	A	2: 29,065,160	H179N	possibly damaging	Het
Ttn	T	C	2: 76,726,173	S30163G	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Ugt1a10	G	A	1: 88,218,390	R519Q	probably damaging	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vwa8	G	A	14: 79,103,697		probably null	Het
Zfp9	A	G	6: 118,464,976	Y242H	probably damaging	Het

Other mutations in Tonsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Tonsl	APN	15	76638496	missense	possibly damaging	0.78
IGL00763:Tonsl	APN	15	76633868	missense	probably damaging	1.00
IGL00796:Tonsl	APN	15	76625149	missense	probably benign
IGL00965:Tonsl	APN	15	76631880	splice site	probably benign
IGL01434:Tonsl	APN	15	76631102	missense	probably benign	0.11
IGL01859:Tonsl	APN	15	76634780	missense	probably damaging	0.97
IGL02112:Tonsl	APN	15	76633402	missense	probably benign	0.01
IGL02189:Tonsl	APN	15	76623178	missense	possibly damaging	0.56
IGL02281:Tonsl	APN	15	76634074	missense	probably damaging	1.00
IGL02627:Tonsl	APN	15	76634095	missense	probably damaging	0.99
IGL02750:Tonsl	APN	15	76633389	missense	probably damaging	0.97
IGL02977:Tonsl	APN	15	76632873	missense	probably benign	0.00
R0127:Tonsl	UTSW	15	76633485	missense	probably benign	0.01
R0316:Tonsl	UTSW	15	76629300	missense	possibly damaging	0.68
R0443:Tonsl	UTSW	15	76639684	missense	probably benign
R0714:Tonsl	UTSW	15	76633721	splice site	probably benign
R0946:Tonsl	UTSW	15	76623221	missense	probably benign	0.03
R0975:Tonsl	UTSW	15	76638932	missense	probably damaging	0.99
R1263:Tonsl	UTSW	15	76622562	missense	possibly damaging	0.85
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1610:Tonsl	UTSW	15	76638557	missense	probably damaging	1.00
R1623:Tonsl	UTSW	15	76638509	missense	probably damaging	1.00
R1763:Tonsl	UTSW	15	76638066	missense	probably damaging	1.00
R1882:Tonsl	UTSW	15	76624150	missense	possibly damaging	0.83
R1898:Tonsl	UTSW	15	76638853	splice site	probably null
R1932:Tonsl	UTSW	15	76624597	missense	probably damaging	0.97
R2141:Tonsl	UTSW	15	76632661	missense	probably damaging	0.99
R2166:Tonsl	UTSW	15	76637313	missense	probably benign	0.13
R2191:Tonsl	UTSW	15	76632680	missense	probably damaging	0.96
R2198:Tonsl	UTSW	15	76636672	missense	probably benign	0.00
R2219:Tonsl	UTSW	15	76634640	missense	probably damaging	1.00
R2762:Tonsl	UTSW	15	76630620	missense	probably damaging	1.00
R3156:Tonsl	UTSW	15	76639521	missense	probably damaging	1.00
R3508:Tonsl	UTSW	15	76639756	missense	probably benign
R4012:Tonsl	UTSW	15	76637044	missense	probably damaging	1.00
R4179:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4180:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4327:Tonsl	UTSW	15	76639716	missense	probably benign
R4671:Tonsl	UTSW	15	76623410	missense	probably benign	0.01
R4825:Tonsl	UTSW	15	76633248	missense	probably benign	0.34
R4840:Tonsl	UTSW	15	76633209	missense	probably benign
R5030:Tonsl	UTSW	15	76638101	missense	probably damaging	1.00
R5143:Tonsl	UTSW	15	76636657	missense	possibly damaging	0.80
R6238:Tonsl	UTSW	15	76636218	splice site	probably null
R6379:Tonsl	UTSW	15	76629742	missense	probably benign
R6401:Tonsl	UTSW	15	76633666	missense	probably damaging	1.00
R6534:Tonsl	UTSW	15	76629677	missense	probably damaging	1.00
R6695:Tonsl	UTSW	15	76629818	missense	possibly damaging	0.84
R6701:Tonsl	UTSW	15	76629300	missense	probably damaging	1.00
R7138:Tonsl	UTSW	15	76634776	missense	probably benign
R7206:Tonsl	UTSW	15	76633651	missense	probably damaging	1.00
R7287:Tonsl	UTSW	15	76633725	splice site	probably null
R7615:Tonsl	UTSW	15	76630607	missense	probably benign	0.44
R7626:Tonsl	UTSW	15	76633936	missense	probably null	1.00
R7641:Tonsl	UTSW	15	76633652	missense	probably damaging	1.00
R7920:Tonsl	UTSW	15	76634587	missense	probably damaging	1.00
R8245:Tonsl	UTSW	15	76636822	missense	probably benign	0.10
R8311:Tonsl	UTSW	15	76633263	missense	probably benign
R8679:Tonsl	UTSW	15	76632876	missense	probably benign	0.19
R8679:Tonsl	UTSW	15	76634063	missense	probably damaging	1.00
R9093:Tonsl	UTSW	15	76631070	missense	probably damaging	0.97
R9143:Tonsl	UTSW	15	76630624	missense	probably damaging	0.96
R9286:Tonsl	UTSW	15	76631013	missense	probably damaging	1.00
Z1177:Tonsl	UTSW	15	76636153	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TAACAGCCAGCTCCAGATCTG -3'
(R):5'- AGACACTTTTCCTGATTCCCAG -3'

Sequencing Primer
(F):5'- AGATCTGGTCTGTTCAGCAGCTC -3'
(R):5'- GATTCCCAGGCTGCTGTCTAAG -3'

Posted On

2015-10-08