Incidental Mutation 'R2176:Noct'
ID236859
Institutional Source Beutler Lab
Gene Symbol Noct
Ensembl Gene ENSMUSG00000023087
Gene Namenocturnin
SynonymsCcrn4l, Ccr4
MMRRC Submission 040178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2176 (G1)
Quality Score85
Status Validated
Chromosome3
Chromosomal Location51224447-51251644 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 51249696 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023849] [ENSMUST00000144826] [ENSMUST00000167780] [ENSMUST00000193018] [ENSMUST00000194641]
Predicted Effect probably null
Transcript: ENSMUST00000023849
SMART Domains Protein: ENSMUSP00000023849
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 3.6e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144826
SMART Domains Protein: ENSMUSP00000141416
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 80 348 6.7e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167780
SMART Domains Protein: ENSMUSP00000130347
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 5.7e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193018
SMART Domains Protein: ENSMUSP00000142216
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
SCOP:d1hd7a_ 52 84 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194641
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Nocturnin, a gene identified as a circadian clock regulated gene in Xenopus laevis. This protein and Nocturnin protein share similarity with the C-terminal domain of a yeast transcription factor, carbon catabolite repression 4 (CCR4). The mRNA abundance of a similar gene in mouse has been shown to exhibit circadian rhythmicity, which suggests a role for this protein in clock function or as a circadian clock effector. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are resistant to diet-induced obesity and fatty liver development, show increased circulating glucose levels and increased insulin sensitivity on a standard diet and have impaired glucose tolerance on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,259,367 probably benign Het
Adam1a T A 5: 121,519,586 Y548F probably benign Het
Armc9 T C 1: 86,199,892 L83P probably damaging Het
BC051665 A T 13: 60,784,530 probably benign Het
Casp3 A G 8: 46,629,756 N3S probably damaging Het
Ccdc174 G A 6: 91,888,089 M109I probably benign Het
Ccr6 T A 17: 8,256,241 F93I probably damaging Het
Clvs2 T C 10: 33,595,815 S165G probably damaging Het
Cntnap5c T C 17: 58,013,946 V171A probably benign Het
Dennd5a C A 7: 109,905,120 probably null Het
Dock2 T A 11: 34,695,217 Y546F probably benign Het
Fat2 A G 11: 55,267,575 probably null Het
Focad T A 4: 88,279,244 Y625N unknown Het
Fyb A G 15: 6,579,954 K3E probably damaging Het
Gm14496 G A 2: 181,991,337 D38N probably benign Het
Gm20403 T C 12: 54,986,370 T54A probably benign Het
Gm9830 A G 9: 44,464,259 noncoding transcript Het
Hectd1 A T 12: 51,745,494 S2487R probably damaging Het
Il5ra A G 6: 106,738,272 L175S probably benign Het
Itgav C T 2: 83,803,255 R983C probably damaging Het
Kcna10 T C 3: 107,194,716 V221A probably damaging Het
Kif13b G A 14: 64,669,671 V35I probably benign Het
Kif6 G A 17: 49,755,230 E473K probably damaging Het
Mfsd14a T C 3: 116,632,393 T452A probably benign Het
Mllt1 A G 17: 56,897,398 S382P probably benign Het
Myo15b T C 11: 115,866,572 W1083R probably damaging Het
Nell2 T C 15: 95,435,157 I174V probably damaging Het
Nvl A T 1: 181,135,074 probably benign Het
Ofcc1 T C 13: 40,097,119 S574G probably benign Het
Olfr1248 A T 2: 89,617,580 M204K possibly damaging Het
Olfr512 G A 7: 108,714,132 V248I probably damaging Het
Olfr749 T C 14: 50,736,224 M313V probably benign Het
Pip5k1a A T 3: 95,065,496 S415T probably damaging Het
Pkhd1 G A 1: 20,553,517 P785S probably damaging Het
Plcg2 A G 8: 117,612,994 Y1048C probably damaging Het
Ppp3cb A T 14: 20,520,652 V337E probably benign Het
Prkg2 T C 5: 98,966,509 probably benign Het
Prl7a2 T G 13: 27,659,106 Y238S probably benign Het
Psg28 T A 7: 18,427,879 D233V probably damaging Het
Rad50 A G 11: 53,698,209 C221R probably benign Het
Rgl3 A G 9: 21,975,958 probably benign Het
Rgsl1 T A 1: 153,825,268 probably benign Het
Ror1 C A 4: 100,441,874 R815S probably damaging Het
Rrp1b C A 17: 32,056,560 D360E probably benign Het
Ryr3 T C 2: 112,666,335 Q3682R possibly damaging Het
Sdr42e1 A T 8: 117,662,877 F342I possibly damaging Het
Setd5 A G 6: 113,151,153 R1337G probably benign Het
Siglecf T C 7: 43,351,716 V36A probably damaging Het
Slc4a5 G A 6: 83,262,560 G152D probably damaging Het
Sptbn4 T G 7: 27,364,162 M2280L probably benign Het
Syngr2 T C 11: 117,812,580 I74T probably damaging Het
Tm9sf1 T C 14: 55,641,409 I175M possibly damaging Het
Tmc3 A G 7: 83,609,308 E502G probably damaging Het
Tph1 T A 7: 46,662,039 D88V possibly damaging Het
Tpr A G 1: 150,419,940 K979E possibly damaging Het
Usp47 A G 7: 112,092,727 T799A probably benign Het
Utf1 A G 7: 139,944,007 E45G possibly damaging Het
Vmn1r208 A T 13: 22,772,602 C242S probably damaging Het
Wrnip1 T C 13: 32,820,240 I498T probably damaging Het
Ypel2 T A 11: 86,971,873 H18L probably benign Het
Zan T G 5: 137,421,848 D2849A unknown Het
Zfp647 A T 15: 76,911,660 F267I probably damaging Het
Zfp786 G T 6: 47,820,971 H344Q possibly damaging Het
Zswim3 G T 2: 164,820,694 A365S probably benign Het
Zswim5 T C 4: 116,973,041 W538R probably damaging Het
Other mutations in Noct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Noct APN 3 51248048 missense probably damaging 0.99
R0256:Noct UTSW 3 51250474 missense probably damaging 1.00
R1399:Noct UTSW 3 51250476 unclassified probably null
R1539:Noct UTSW 3 51247912 nonsense probably null
R1618:Noct UTSW 3 51247830 missense probably damaging 1.00
R2001:Noct UTSW 3 51248044 missense probably damaging 1.00
R2408:Noct UTSW 3 51225289 critical splice donor site probably null
R4413:Noct UTSW 3 51250335 missense probably damaging 1.00
R4552:Noct UTSW 3 51250168 missense probably benign 0.16
R4690:Noct UTSW 3 51247879 nonsense probably null
R4993:Noct UTSW 3 51250021 missense probably damaging 1.00
R5009:Noct UTSW 3 51248061 missense probably damaging 1.00
R6467:Noct UTSW 3 51250087 missense possibly damaging 0.90
R6631:Noct UTSW 3 51250200 missense probably damaging 1.00
R7454:Noct UTSW 3 51249730 missense probably damaging 1.00
R7467:Noct UTSW 3 51225201 missense probably benign 0.01
R7992:Noct UTSW 3 51247648 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAATGTCAGACATCCAAGC -3'
(R):5'- AGTCTACTGAGGAGTGGCTG -3'

Sequencing Primer
(F):5'- TGTCAGACATCCAAGCTTCTAC -3'
(R):5'- CTGGAAGGTGTCAAAGTAGTGGTCC -3'
Posted On2014-10-02