Mutagenetix > Incidental Mutation

Incidental Mutation 'R2176:Itgav'

236854

Institutional Source

Beutler Lab

Gene Symbol

Itgav

Ensembl Gene

ENSMUSG00000027087

Gene Name

integrin alpha V

Synonyms

alphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik

MMRRC Submission

040178-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2176 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83724397-83806916 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83803255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 983 (R983C)

Ref Sequence

ENSEMBL: ENSMUSP00000107369 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]

AlphaFold

P43406

Predicted Effect

probably damaging
Transcript: ENSMUST00000028499
AA Change: R1019C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: R1019C

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	248	298	4.9e-13	SMART
Int_alpha	302	363	4.55e-8	SMART
Int_alpha	366	422	2.2e-15	SMART
Int_alpha	430	484	1.62e-4	SMART
SCOP:d1m1xa2	629	767	3e-49	SMART
SCOP:d1m1xa3	768	982	1e-89	SMART
low complexity region	995	1008	N/A	INTRINSIC
Pfam:Integrin_alpha	1013	1027	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111740
AA Change: R983C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: R983C

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	104	1.05e-3	SMART
Int_alpha	212	262	4.9e-13	SMART
Int_alpha	266	327	4.55e-8	SMART
Int_alpha	330	386	2.2e-15	SMART
Int_alpha	394	448	1.62e-4	SMART
SCOP:d1m1xa2	593	731	5e-49	SMART
SCOP:d1m1xa3	732	946	2e-89	SMART
low complexity region	959	972	N/A	INTRINSIC
Pfam:Integrin_alpha	977	991	1.3e-7	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000125402
AA Change: R94C

SMART Domains

Protein: ENSMUSP00000118016
Gene: ENSMUSG00000027087
AA Change: R94C

Domain	Start	End	E-Value	Type
SCOP:d1m1xa3	2	58	7e-19	SMART
PDB:3IJE\|A	2	69	3e-41	PDB
low complexity region	71	84	N/A	INTRINSIC
Pfam:Integrin_alpha	89	103	1.4e-8	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000131192
AA Change: R33C

SMART Domains

Protein: ENSMUSP00000121295
Gene: ENSMUSG00000027087
AA Change: R33C

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Integrin_alpha	28	42	4.5e-9	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,259,367		probably benign	Het
Adam1a	T	A	5: 121,519,586	Y548F	probably benign	Het
Armc9	T	C	1: 86,199,892	L83P	probably damaging	Het
BC051665	A	T	13: 60,784,530		probably benign	Het
Casp3	A	G	8: 46,629,756	N3S	probably damaging	Het
Ccdc174	G	A	6: 91,888,089	M109I	probably benign	Het
Ccr6	T	A	17: 8,256,241	F93I	probably damaging	Het
Clvs2	T	C	10: 33,595,815	S165G	probably damaging	Het
Cntnap5c	T	C	17: 58,013,946	V171A	probably benign	Het
Dennd5a	C	A	7: 109,905,120		probably null	Het
Dock2	T	A	11: 34,695,217	Y546F	probably benign	Het
Fat2	A	G	11: 55,267,575		probably null	Het
Focad	T	A	4: 88,279,244	Y625N	unknown	Het
Fyb	A	G	15: 6,579,954	K3E	probably damaging	Het
Gm14496	G	A	2: 181,991,337	D38N	probably benign	Het
Gm20403	T	C	12: 54,986,370	T54A	probably benign	Het
Gm9830	A	G	9: 44,464,259		noncoding transcript	Het
Hectd1	A	T	12: 51,745,494	S2487R	probably damaging	Het
Il5ra	A	G	6: 106,738,272	L175S	probably benign	Het
Kcna10	T	C	3: 107,194,716	V221A	probably damaging	Het
Kif13b	G	A	14: 64,669,671	V35I	probably benign	Het
Kif6	G	A	17: 49,755,230	E473K	probably damaging	Het
Mfsd14a	T	C	3: 116,632,393	T452A	probably benign	Het
Mllt1	A	G	17: 56,897,398	S382P	probably benign	Het
Myo15b	T	C	11: 115,866,572	W1083R	probably damaging	Het
Nell2	T	C	15: 95,435,157	I174V	probably damaging	Het
Noct	G	A	3: 51,249,696		probably null	Het
Nvl	A	T	1: 181,135,074		probably benign	Het
Ofcc1	T	C	13: 40,097,119	S574G	probably benign	Het
Olfr1248	A	T	2: 89,617,580	M204K	possibly damaging	Het
Olfr512	G	A	7: 108,714,132	V248I	probably damaging	Het
Olfr749	T	C	14: 50,736,224	M313V	probably benign	Het
Pip5k1a	A	T	3: 95,065,496	S415T	probably damaging	Het
Pkhd1	G	A	1: 20,553,517	P785S	probably damaging	Het
Plcg2	A	G	8: 117,612,994	Y1048C	probably damaging	Het
Ppp3cb	A	T	14: 20,520,652	V337E	probably benign	Het
Prkg2	T	C	5: 98,966,509		probably benign	Het
Prl7a2	T	G	13: 27,659,106	Y238S	probably benign	Het
Psg28	T	A	7: 18,427,879	D233V	probably damaging	Het
Rad50	A	G	11: 53,698,209	C221R	probably benign	Het
Rgl3	A	G	9: 21,975,958		probably benign	Het
Rgsl1	T	A	1: 153,825,268		probably benign	Het
Ror1	C	A	4: 100,441,874	R815S	probably damaging	Het
Rrp1b	C	A	17: 32,056,560	D360E	probably benign	Het
Ryr3	T	C	2: 112,666,335	Q3682R	possibly damaging	Het
Sdr42e1	A	T	8: 117,662,877	F342I	possibly damaging	Het
Setd5	A	G	6: 113,151,153	R1337G	probably benign	Het
Siglecf	T	C	7: 43,351,716	V36A	probably damaging	Het
Slc4a5	G	A	6: 83,262,560	G152D	probably damaging	Het
Sptbn4	T	G	7: 27,364,162	M2280L	probably benign	Het
Syngr2	T	C	11: 117,812,580	I74T	probably damaging	Het
Tm9sf1	T	C	14: 55,641,409	I175M	possibly damaging	Het
Tmc3	A	G	7: 83,609,308	E502G	probably damaging	Het
Tph1	T	A	7: 46,662,039	D88V	possibly damaging	Het
Tpr	A	G	1: 150,419,940	K979E	possibly damaging	Het
Usp47	A	G	7: 112,092,727	T799A	probably benign	Het
Utf1	A	G	7: 139,944,007	E45G	possibly damaging	Het
Vmn1r208	A	T	13: 22,772,602	C242S	probably damaging	Het
Wrnip1	T	C	13: 32,820,240	I498T	probably damaging	Het
Ypel2	T	A	11: 86,971,873	H18L	probably benign	Het
Zan	T	G	5: 137,421,848	D2849A	unknown	Het
Zfp647	A	T	15: 76,911,660	F267I	probably damaging	Het
Zfp786	G	T	6: 47,820,971	H344Q	possibly damaging	Het
Zswim3	G	T	2: 164,820,694	A365S	probably benign	Het
Zswim5	T	C	4: 116,973,041	W538R	probably damaging	Het

Other mutations in Itgav

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Itgav	APN	2	83802995	missense	probably damaging	1.00
IGL01969:Itgav	APN	2	83803283	missense	probably damaging	1.00
IGL02371:Itgav	APN	2	83770053	missense	probably damaging	1.00
IGL02563:Itgav	APN	2	83771236	missense	probably benign
IGL02640:Itgav	APN	2	83791939	missense	probably benign	0.33
IGL02641:Itgav	APN	2	83768345	splice site	probably benign
IGL02927:Itgav	APN	2	83795540	missense	probably damaging	1.00
IGL03172:Itgav	APN	2	83765846	missense	possibly damaging	0.51
R0158:Itgav	UTSW	2	83792037	missense	probably benign	0.33
R0346:Itgav	UTSW	2	83792609	missense	probably damaging	1.00
R0508:Itgav	UTSW	2	83792658	splice site	probably benign
R0546:Itgav	UTSW	2	83803242	missense	probably benign	0.04
R0554:Itgav	UTSW	2	83794270	missense	possibly damaging	0.95
R1122:Itgav	UTSW	2	83791939	missense	probably benign	0.33
R1468:Itgav	UTSW	2	83765901	splice site	probably benign
R1566:Itgav	UTSW	2	83736630	missense	probably damaging	1.00
R1657:Itgav	UTSW	2	83801779	missense	probably benign	0.21
R1892:Itgav	UTSW	2	83771336	missense	probably damaging	1.00
R1912:Itgav	UTSW	2	83795486	missense	possibly damaging	0.85
R2438:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R2449:Itgav	UTSW	2	83768750	critical splice donor site	probably null
R3110:Itgav	UTSW	2	83792571	nonsense	probably null
R3112:Itgav	UTSW	2	83792571	nonsense	probably null
R3176:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3177:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3276:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3277:Itgav	UTSW	2	83776542	missense	probably damaging	1.00
R3766:Itgav	UTSW	2	83801885	critical splice donor site	probably null
R3774:Itgav	UTSW	2	83791964	missense	probably damaging	1.00
R3880:Itgav	UTSW	2	83768301	missense	probably damaging	1.00
R4196:Itgav	UTSW	2	83768327	missense	probably benign	0.24
R4287:Itgav	UTSW	2	83724840	nonsense	probably null
R4620:Itgav	UTSW	2	83755902	missense	probably benign	0.07
R4790:Itgav	UTSW	2	83755810	missense	probably damaging	1.00
R4946:Itgav	UTSW	2	83788983	missense	probably benign	0.16
R6150:Itgav	UTSW	2	83776436	missense	probably benign
R6345:Itgav	UTSW	2	83802036	missense	probably damaging	1.00
R6482:Itgav	UTSW	2	83794270	missense	probably damaging	1.00
R6900:Itgav	UTSW	2	83803247	missense	probably damaging	1.00
R7247:Itgav	UTSW	2	83724835	missense	probably damaging	0.98
R7317:Itgav	UTSW	2	83794983	missense	probably benign	0.12
R7429:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7430:Itgav	UTSW	2	83794258	missense	probably damaging	1.00
R7522:Itgav	UTSW	2	83802029	missense	probably benign	0.10
R7546:Itgav	UTSW	2	83776550	nonsense	probably null
R7578:Itgav	UTSW	2	83747875	missense	probably benign	0.16
R8311:Itgav	UTSW	2	83765777	missense	probably damaging	1.00
R8497:Itgav	UTSW	2	83785461	missense	probably damaging	1.00
R8744:Itgav	UTSW	2	83770083	missense	probably benign	0.25
R9752:Itgav	UTSW	2	83770107	critical splice donor site	probably null
V1662:Itgav	UTSW	2	83783854	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ATCTTGGCAGTTCTCGCAGG -3'
(R):5'- CCTGGGATTTCACTGTTCACG -3'

Sequencing Primer
(F):5'- AGGGCTGCTGCTACTGG -3'
(R):5'- GTTCACGAGAGATGTTGAAATCCACC -3'

Posted On

2014-10-02