Incidental Mutation 'R0165:Rbl2'
ID 24109
Institutional Source Beutler Lab
Gene Symbol Rbl2
Ensembl Gene ENSMUSG00000031666
Gene Name RB transcriptional corepressor like 2
Synonyms p130, Rb2
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0165 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 8
Chromosomal Location 91070057-91123844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91074176 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 89 (Y89N)
Ref Sequence ENSEMBL: ENSMUSP00000147579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000209518] [ENSMUST00000211136]
AlphaFold Q64700
Predicted Effect probably damaging
Transcript: ENSMUST00000034091
AA Change: Y89N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666
AA Change: Y89N

low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141351
Predicted Effect probably damaging
Transcript: ENSMUST00000209518
AA Change: Y89N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210533
Predicted Effect probably damaging
Transcript: ENSMUST00000211136
AA Change: Y89N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9305 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype PHENOTYPE: Nullizygous mice generally show no overt phenotype. Homozygotes for a null allele show strain-dependent embryonic lethality and growth arrest associated with altered apoptosis and cell proliferation, impaired neurogenesis and myogenesis, failed embryo turning and heart looping, and thin myocardium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Rbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rbl2 APN 8 91085445 missense probably damaging 1.00
IGL01084:Rbl2 APN 8 91122313 missense probably damaging 0.99
IGL01317:Rbl2 APN 8 91100057 missense probably damaging 1.00
IGL01637:Rbl2 APN 8 91106438 missense probably benign
IGL01843:Rbl2 APN 8 91090216 missense probably benign 0.11
IGL01884:Rbl2 APN 8 91096836 missense probably damaging 1.00
IGL02071:Rbl2 APN 8 91102198 missense probably damaging 1.00
IGL02588:Rbl2 APN 8 91087084 missense probably damaging 0.99
IGL03027:Rbl2 APN 8 91078906 missense possibly damaging 0.92
IGL03162:Rbl2 APN 8 91085702 missense probably benign 0.01
IGL03200:Rbl2 APN 8 91096767 missense probably benign 0.00
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0238:Rbl2 UTSW 8 91106507 missense probably damaging 0.99
R0317:Rbl2 UTSW 8 91087144 missense probably benign 0.00
R0539:Rbl2 UTSW 8 91112505 splice site probably benign
R1532:Rbl2 UTSW 8 91106417 missense probably benign 0.01
R1696:Rbl2 UTSW 8 91085724 missense probably benign 0.12
R1852:Rbl2 UTSW 8 91095563 missense possibly damaging 0.84
R1866:Rbl2 UTSW 8 91112529 missense probably benign 0.00
R1975:Rbl2 UTSW 8 91085462 missense probably benign
R2062:Rbl2 UTSW 8 91106739 missense probably damaging 1.00
R2180:Rbl2 UTSW 8 91090055 missense possibly damaging 0.51
R2423:Rbl2 UTSW 8 91087146 missense probably benign 0.34
R3109:Rbl2 UTSW 8 91102235 missense probably benign
R4356:Rbl2 UTSW 8 91107107 missense probably damaging 0.97
R4692:Rbl2 UTSW 8 91122419 missense probably damaging 1.00
R4707:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R4784:Rbl2 UTSW 8 91085568 missense probably damaging 1.00
R5084:Rbl2 UTSW 8 91115131 missense probably benign 0.43
R5432:Rbl2 UTSW 8 91102283 missense probably benign 0.01
R5493:Rbl2 UTSW 8 91115819 missense probably damaging 1.00
R5546:Rbl2 UTSW 8 91078932 missense probably benign 0.00
R5918:Rbl2 UTSW 8 91090130 missense probably benign 0.02
R6186:Rbl2 UTSW 8 91106730 missense probably damaging 1.00
R6257:Rbl2 UTSW 8 91115678 missense probably damaging 1.00
R6526:Rbl2 UTSW 8 91096839 missense probably benign 0.04
R6546:Rbl2 UTSW 8 91070370 missense probably benign
R6714:Rbl2 UTSW 8 91106787 missense possibly damaging 0.91
R7214:Rbl2 UTSW 8 91083429 critical splice donor site probably null
R7286:Rbl2 UTSW 8 91102294 nonsense probably null
R7290:Rbl2 UTSW 8 91115041 missense probably benign 0.33
R7315:Rbl2 UTSW 8 91076012 missense probably damaging 0.96
R7524:Rbl2 UTSW 8 91115193 missense probably benign
R8060:Rbl2 UTSW 8 91096869 critical splice donor site probably null
R8071:Rbl2 UTSW 8 91113989 missense probably damaging 1.00
R8154:Rbl2 UTSW 8 91107197 missense probably damaging 1.00
R8302:Rbl2 UTSW 8 91085445 missense probably damaging 1.00
R8344:Rbl2 UTSW 8 91115759 missense possibly damaging 0.89
R8724:Rbl2 UTSW 8 91115209 missense possibly damaging 0.54
R8822:Rbl2 UTSW 8 91106718 missense possibly damaging 0.95
R9186:Rbl2 UTSW 8 91101378 missense probably damaging 1.00
X0023:Rbl2 UTSW 8 91090079 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cataaaactctgccctgcttc -3'
Posted On 2013-04-16