Incidental Mutation 'R2219:Zfp879'
ID241352
Institutional Source Beutler Lab
Gene Symbol Zfp879
Ensembl Gene ENSMUSG00000044296
Gene Namezinc finger protein 879
Synonyms
MMRRC Submission 040221-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2219 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50832031-50841552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50833267 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 321 (C321R)
Ref Sequence ENSEMBL: ENSMUSP00000104762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049625] [ENSMUST00000109133] [ENSMUST00000109134]
Predicted Effect probably damaging
Transcript: ENSMUST00000049625
AA Change: C321R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061782
Gene: ENSMUSG00000044296
AA Change: C321R

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109133
AA Change: C248R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104761
Gene: ENSMUSG00000044296
AA Change: C248R

DomainStartEndE-ValueType
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 1.16e-1 SMART
ZnF_C2H2 215 237 4.54e-4 SMART
ZnF_C2H2 243 265 8.34e-3 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 8.47e-4 SMART
ZnF_C2H2 327 349 1.84e-4 SMART
ZnF_C2H2 355 377 2.57e-3 SMART
ZnF_C2H2 383 405 1.47e-3 SMART
ZnF_C2H2 411 433 3.21e-4 SMART
ZnF_C2H2 439 461 1.5e-4 SMART
ZnF_C2H2 467 489 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109134
AA Change: C321R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104762
Gene: ENSMUSG00000044296
AA Change: C321R

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,446,345 Y160H probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre1 T A 17: 57,401,912 N34K possibly damaging Het
Ago2 T A 15: 73,146,411 E59D probably benign Het
Akap8l G T 17: 32,334,631 Q372K probably benign Het
Aox2 A G 1: 58,349,130 probably null Het
Apc2 T C 10: 80,309,109 V618A probably benign Het
Cacna1d A T 14: 30,042,090 C2140S probably damaging Het
Cadps2 A G 6: 23,410,832 L671P probably damaging Het
Capn9 C T 8: 124,609,159 R529* probably null Het
Ccdc180 T A 4: 45,944,949 N1452K probably damaging Het
Cdh5 A T 8: 104,142,906 I755F possibly damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Champ1 A G 8: 13,880,017 H725R probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Cpne7 G T 8: 123,124,438 V155L probably benign Het
Dhx29 T C 13: 112,952,804 V703A probably damaging Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dmc1 T A 15: 79,585,126 H156L possibly damaging Het
Dnmt3a A G 12: 3,849,654 probably benign Het
Dst C G 1: 34,170,433 L869V probably damaging Het
Eif3d A T 15: 77,964,942 M180K probably benign Het
Erbb3 T C 10: 128,569,871 T1173A probably damaging Het
Fat4 A T 3: 39,010,215 K4773N probably damaging Het
Fbn2 G A 18: 58,052,963 P1771L possibly damaging Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Fermt2 G A 14: 45,475,897 T87I probably benign Het
Fpr3 T A 17: 17,971,382 M305K possibly damaging Het
Fzd2 A G 11: 102,605,423 E231G probably benign Het
Ggcx T C 6: 72,427,982 Y458H probably benign Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Gm5475 A G 15: 100,424,213 probably benign Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Itln1 T A 1: 171,531,547 T122S probably damaging Het
Itpr3 T A 17: 27,115,053 L2033Q probably benign Het
Lama2 T C 10: 27,043,569 D2222G probably damaging Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Ly9 T C 1: 171,597,681 probably null Het
Man1a T C 10: 53,977,049 I324M probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Mmp15 A G 8: 95,370,173 D398G probably benign Het
Mybpc1 T A 10: 88,555,678 D319V probably damaging Het
Olfr1154 A C 2: 87,902,925 Y250* probably null Het
Olfr1251 A T 2: 89,667,867 N6K possibly damaging Het
Olfr1256 A T 2: 89,835,425 D173E probably damaging Het
Olfr1260 G A 2: 89,977,912 V45I possibly damaging Het
Olfr1314 A T 2: 112,092,407 I98N probably damaging Het
Olfr1467 T A 19: 13,365,537 I303N possibly damaging Het
Olfr288 T A 15: 98,186,967 K277* probably null Het
Olfr467 G A 7: 107,815,222 V213I probably benign Het
Otogl C T 10: 107,856,977 C882Y probably damaging Het
Parp10 A G 15: 76,233,583 Y868H probably damaging Het
Pick1 T A 15: 79,239,699 I90N probably damaging Het
Piezo1 C T 8: 122,491,488 V1170I probably benign Het
Pim3 G A 15: 88,862,912 V54I possibly damaging Het
Pinlyp T C 7: 24,546,008 probably benign Het
Ppfia3 G A 7: 45,354,890 Q473* probably null Het
Rab3gap2 G A 1: 185,275,916 G1056E probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Reln T C 5: 21,972,047 T1874A possibly damaging Het
Rftn1 C A 17: 50,169,145 M1I probably null Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc17a9 A G 2: 180,731,962 T59A probably benign Het
Slc26a5 T C 5: 21,823,478 K364R probably damaging Het
Slitrk2 T C X: 66,655,148 I415T probably damaging Het
Stom A G 2: 35,321,601 I136T possibly damaging Het
Strc G T 2: 121,364,523 P1728T probably damaging Het
Telo2 C A 17: 25,103,699 V640F probably benign Het
Tg T C 15: 66,681,933 V399A probably benign Het
Tmem214 A G 5: 30,873,631 K383E possibly damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Tonsl A T 15: 76,634,640 N526K probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tymp T A 15: 89,374,762 M240L probably benign Het
Ubr2 A T 17: 46,986,042 S271T possibly damaging Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Ugt2b35 T A 5: 87,003,332 F266I possibly damaging Het
Vmn2r103 C T 17: 19,793,647 R234W probably damaging Het
Zfp109 C A 7: 24,228,461 D508Y probably damaging Het
Zfp623 T C 15: 75,947,530 S112P possibly damaging Het
Zfp735 A G 11: 73,711,025 N265S possibly damaging Het
Other mutations in Zfp879
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Zfp879 APN 11 50838454 missense probably damaging 1.00
IGL02175:Zfp879 APN 11 50837916 missense probably benign 0.13
IGL02259:Zfp879 APN 11 50838428 missense probably benign 0.00
R0131:Zfp879 UTSW 11 50833599 missense probably damaging 1.00
R1430:Zfp879 UTSW 11 50833957 missense probably benign 0.00
R1576:Zfp879 UTSW 11 50833549 missense probably benign 0.41
R1616:Zfp879 UTSW 11 50832646 missense probably benign 0.06
R1701:Zfp879 UTSW 11 50833233 missense possibly damaging 0.77
R1965:Zfp879 UTSW 11 50833528 missense probably damaging 1.00
R2057:Zfp879 UTSW 11 50832601 missense probably benign
R2058:Zfp879 UTSW 11 50832601 missense probably benign
R3110:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R3112:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R4658:Zfp879 UTSW 11 50833197 missense probably damaging 1.00
R4845:Zfp879 UTSW 11 50833845 missense probably damaging 1.00
R4998:Zfp879 UTSW 11 50837969 missense probably damaging 1.00
R6362:Zfp879 UTSW 11 50838475 missense probably damaging 0.98
R6930:Zfp879 UTSW 11 50833012 missense probably damaging 1.00
R7091:Zfp879 UTSW 11 50833395 missense probably damaging 0.99
R7186:Zfp879 UTSW 11 50833794 missense probably benign 0.06
R7218:Zfp879 UTSW 11 50832681 missense possibly damaging 0.61
R8138:Zfp879 UTSW 11 50833448 nonsense probably null
X0066:Zfp879 UTSW 11 50833087 missense possibly damaging 0.89
Z1177:Zfp879 UTSW 11 50833431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCCGTGAGAGCCAGG -3'
(R):5'- GGAAAGTCTTCTTCCACAGTTCCTC -3'

Sequencing Primer
(F):5'- CGAGTGGTAACTGAACACTTTGCC -3'
(R):5'- AAAGCCGTACCTCTGTAGTGACTG -3'
Posted On2014-10-15