Incidental Mutation 'R6930:Zfp879'
ID539968
Institutional Source Beutler Lab
Gene Symbol Zfp879
Ensembl Gene ENSMUSG00000044296
Gene Namezinc finger protein 879
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6930 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50832031-50841552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50833012 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 406 (G406R)
Ref Sequence ENSEMBL: ENSMUSP00000104762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049625] [ENSMUST00000109133] [ENSMUST00000109134]
Predicted Effect probably damaging
Transcript: ENSMUST00000049625
AA Change: G406R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061782
Gene: ENSMUSG00000044296
AA Change: G406R

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109133
AA Change: G333R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104761
Gene: ENSMUSG00000044296
AA Change: G333R

DomainStartEndE-ValueType
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 1.16e-1 SMART
ZnF_C2H2 215 237 4.54e-4 SMART
ZnF_C2H2 243 265 8.34e-3 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 8.47e-4 SMART
ZnF_C2H2 327 349 1.84e-4 SMART
ZnF_C2H2 355 377 2.57e-3 SMART
ZnF_C2H2 383 405 1.47e-3 SMART
ZnF_C2H2 411 433 3.21e-4 SMART
ZnF_C2H2 439 461 1.5e-4 SMART
ZnF_C2H2 467 489 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109134
AA Change: G406R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104762
Gene: ENSMUSG00000044296
AA Change: G406R

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
D630045J12Rik T C 6: 38,158,216 D1343G probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Flg2 T A 3: 93,201,335 Y223* probably null Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gimap9 G A 6: 48,677,667 D53N probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Hace1 A G 10: 45,618,502 H136R probably damaging Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pold1 A G 7: 44,542,206 S119P probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rbm33 T C 5: 28,352,506 I199T probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zic2 A T 14: 122,476,457 D261V probably damaging Het
Other mutations in Zfp879
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Zfp879 APN 11 50838454 missense probably damaging 1.00
IGL02175:Zfp879 APN 11 50837916 missense probably benign 0.13
IGL02259:Zfp879 APN 11 50838428 missense probably benign 0.00
R0131:Zfp879 UTSW 11 50833599 missense probably damaging 1.00
R1430:Zfp879 UTSW 11 50833957 missense probably benign 0.00
R1576:Zfp879 UTSW 11 50833549 missense probably benign 0.41
R1616:Zfp879 UTSW 11 50832646 missense probably benign 0.06
R1701:Zfp879 UTSW 11 50833233 missense possibly damaging 0.77
R1965:Zfp879 UTSW 11 50833528 missense probably damaging 1.00
R2057:Zfp879 UTSW 11 50832601 missense probably benign
R2058:Zfp879 UTSW 11 50832601 missense probably benign
R2219:Zfp879 UTSW 11 50833267 missense probably damaging 1.00
R3110:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R3112:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R4658:Zfp879 UTSW 11 50833197 missense probably damaging 1.00
R4845:Zfp879 UTSW 11 50833845 missense probably damaging 1.00
R4998:Zfp879 UTSW 11 50837969 missense probably damaging 1.00
R6362:Zfp879 UTSW 11 50838475 missense probably damaging 0.98
R7091:Zfp879 UTSW 11 50833395 missense probably damaging 0.99
R7186:Zfp879 UTSW 11 50833794 missense probably benign 0.06
R7218:Zfp879 UTSW 11 50832681 missense possibly damaging 0.61
X0066:Zfp879 UTSW 11 50833087 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACGCTTTCCCGCAAGCT -3'
(R):5'- CACCACCTCTCTCATTGGG -3'

Sequencing Primer
(F):5'- CCTCATATGTGTCATAAGCGAGG -3'
(R):5'- CCATATGAATGCAGCCAGTGTG -3'
Posted On2018-11-06