Incidental Mutation 'R1576:Zfp879'
ID171175
Institutional Source Beutler Lab
Gene Symbol Zfp879
Ensembl Gene ENSMUSG00000044296
Gene Namezinc finger protein 879
Synonyms
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50832031-50841552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50833549 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 227 (T227S)
Ref Sequence ENSEMBL: ENSMUSP00000104762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049625] [ENSMUST00000109133] [ENSMUST00000109134]
Predicted Effect probably benign
Transcript: ENSMUST00000049625
AA Change: T227S

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061782
Gene: ENSMUSG00000044296
AA Change: T227S

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109133
AA Change: T154S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104761
Gene: ENSMUSG00000044296
AA Change: T154S

DomainStartEndE-ValueType
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 1.16e-1 SMART
ZnF_C2H2 215 237 4.54e-4 SMART
ZnF_C2H2 243 265 8.34e-3 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 8.47e-4 SMART
ZnF_C2H2 327 349 1.84e-4 SMART
ZnF_C2H2 355 377 2.57e-3 SMART
ZnF_C2H2 383 405 1.47e-3 SMART
ZnF_C2H2 411 433 3.21e-4 SMART
ZnF_C2H2 439 461 1.5e-4 SMART
ZnF_C2H2 467 489 5.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109134
AA Change: T227S

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104762
Gene: ENSMUSG00000044296
AA Change: T227S

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Sstr5 C T 17: 25,491,298 C319Y possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Other mutations in Zfp879
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Zfp879 APN 11 50838454 missense probably damaging 1.00
IGL02175:Zfp879 APN 11 50837916 missense probably benign 0.13
IGL02259:Zfp879 APN 11 50838428 missense probably benign 0.00
R0131:Zfp879 UTSW 11 50833599 missense probably damaging 1.00
R1430:Zfp879 UTSW 11 50833957 missense probably benign 0.00
R1616:Zfp879 UTSW 11 50832646 missense probably benign 0.06
R1701:Zfp879 UTSW 11 50833233 missense possibly damaging 0.77
R1965:Zfp879 UTSW 11 50833528 missense probably damaging 1.00
R2057:Zfp879 UTSW 11 50832601 missense probably benign
R2058:Zfp879 UTSW 11 50832601 missense probably benign
R2219:Zfp879 UTSW 11 50833267 missense probably damaging 1.00
R3110:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R3112:Zfp879 UTSW 11 50833162 missense possibly damaging 0.87
R4658:Zfp879 UTSW 11 50833197 missense probably damaging 1.00
R4845:Zfp879 UTSW 11 50833845 missense probably damaging 1.00
R4998:Zfp879 UTSW 11 50837969 missense probably damaging 1.00
R6362:Zfp879 UTSW 11 50838475 missense probably damaging 0.98
R6930:Zfp879 UTSW 11 50833012 missense probably damaging 1.00
R7091:Zfp879 UTSW 11 50833395 missense probably damaging 0.99
R7186:Zfp879 UTSW 11 50833794 missense probably benign 0.06
R7218:Zfp879 UTSW 11 50832681 missense possibly damaging 0.61
R8138:Zfp879 UTSW 11 50833448 nonsense probably null
X0066:Zfp879 UTSW 11 50833087 missense possibly damaging 0.89
Z1177:Zfp879 UTSW 11 50833431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCTGCTCAGCCGTGATATTGA -3'
(R):5'- TTTCGTAGGAAACCTGGAGTTGCC -3'

Sequencing Primer
(F):5'- gtcttgccacattccttacattc -3'
(R):5'- CCCACTTACAGCAGTACTCAGTT -3'
Posted On2014-04-13