Incidental Mutation 'R2327:Gm10184'
ID245735
Institutional Source Beutler Lab
Gene Symbol Gm10184
Ensembl Gene ENSMUSG00000066878
Gene Namepredicted pseudogene 10184
Synonyms
MMRRC Submission 040318-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2327 (G1)
Quality Score154
Status Not validated
Chromosome17
Chromosomal Location89908511-89910449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89910269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 16 (R16S)
Ref Sequence ENSEMBL: ENSMUSP00000137310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086423]
PDB Structure
MOUSE IMPORTIN ALPHA-SV40 LARGE T ANTIGEN NLS PEPTIDE COMPLEX [X-RAY DIFFRACTION]
MOUSE IMPORTIN ALPHA-NUCLEOPLASMIN NLS PEPTIDE COMPLEX [X-RAY DIFFRACTION]
IMPORTIN ALPHA, MOUSE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE IMPORTIN-ALPHA(44-54)-IMPORTIN-ALPHA(70-529) COMPLEX [X-RAY DIFFRACTION]
Mouse Importin alpha-bipartite NLS from human retinoblastoma protein Complex [X-RAY DIFFRACTION]
Mouse Importin alpha-bipartite NLS N1N2 from Xenopus laevis phosphoprotein Complex [X-RAY DIFFRACTION]
Mouse Importin alpha- phosphorylated SV40 CN peptide complex [X-RAY DIFFRACTION]
Mouse Importin alpha: non-phosphorylated SV40 CN peptide complex [X-RAY DIFFRACTION]
Structure of mammalian importin bound to the non-classical PLSCR1-NLS [X-RAY DIFFRACTION]
NUP50:IMPORTIN-ALPHA COMPLEX [X-RAY DIFFRACTION]
>> 29 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000086423
AA Change: R16S

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137310
Gene: ENSMUSG00000066878
AA Change: R16S

DomainStartEndE-ValueType
Pfam:IBB 9 98 2.8e-32 PFAM
ARM 108 149 8.95e-7 SMART
ARM 151 191 1.33e-9 SMART
ARM 193 231 2.7e-1 SMART
ARM 241 280 1.74e-4 SMART
ARM 282 322 1.92e-6 SMART
ARM 324 364 2.76e-7 SMART
ARM 366 406 3.45e-8 SMART
ARM 409 449 2.17e-5 SMART
Pfam:Arm_3 458 509 3.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 63,971,120 probably null Het
Agbl4 T G 4: 111,526,601 S218A probably benign Het
Apol11b T C 15: 77,637,953 E48G probably damaging Het
Atp4a T A 7: 30,720,241 N676K probably benign Het
Capn5 T A 7: 98,126,367 S456C probably benign Het
Ccar1 T C 10: 62,764,382 Y590C probably damaging Het
Ccdc188 G T 16: 18,219,206 G283W probably damaging Het
Cd163l1 A T 7: 140,223,977 N363Y possibly damaging Het
Cd69 A G 6: 129,271,388 V45A probably damaging Het
Col3a1 G T 1: 45,338,611 probably benign Het
Cyb561a3 A T 19: 10,586,802 T169S probably benign Het
Cyp2c39 A T 19: 39,538,953 I248L probably benign Het
Cyp2j13 T C 4: 96,059,107 T236A possibly damaging Het
Efs A G 14: 54,917,504 V426A probably benign Het
Eme2 A G 17: 24,894,183 L136S probably damaging Het
Fastkd1 T A 2: 69,705,528 K312* probably null Het
Fbxl12 A G 9: 20,642,234 L19P probably damaging Het
Flg2 T A 3: 93,203,606 Y980* probably null Het
Fscn2 T A 11: 120,366,701 I296N probably damaging Het
Gabrg3 A G 7: 56,735,087 V242A probably benign Het
Galk2 A G 2: 125,975,395 H368R probably damaging Het
Gm12695 C T 4: 96,769,656 S92N probably benign Het
Gpalpp1 A T 14: 76,098,591 S196T probably benign Het
Gpld1 A T 13: 24,984,821 M773L probably benign Het
Haus8 A G 8: 71,255,645 probably null Het
Hirip3 A G 7: 126,862,866 R19G probably damaging Het
Inpp4a A G 1: 37,366,166 T92A probably damaging Het
Irgm2 A G 11: 58,220,392 D303G probably damaging Het
Krtap5-2 T G 7: 142,175,011 S311R unknown Het
Krtdap T A 7: 30,789,760 probably null Het
Lce1g G T 3: 92,750,833 S56Y unknown Het
Lrrn1 G A 6: 107,568,833 V531I probably benign Het
Mctp2 T C 7: 72,211,610 E429G probably damaging Het
Mrgpra2b T G 7: 47,464,045 D287A probably damaging Het
Mterf3 T C 13: 66,928,194 T150A probably damaging Het
Mtus2 A G 5: 148,077,915 N506S probably benign Het
Myh15 G T 16: 49,142,950 V1085L probably benign Het
Myo9a A G 9: 59,779,765 N51S probably benign Het
Nlrc3 A T 16: 3,953,440 L196Q probably damaging Het
Nlrp9c T A 7: 26,375,322 N816I probably damaging Het
Nsun2 T C 13: 69,619,581 V218A probably benign Het
Nt5dc1 T C 10: 34,313,677 E339G possibly damaging Het
Olfr1062 A T 2: 86,422,821 L285* probably null Het
Olfr1338 C T 4: 118,754,134 V135I probably benign Het
Olfr623 A G 7: 103,660,572 V226A probably damaging Het
Pik3ap1 A G 19: 41,296,389 I619T probably damaging Het
Plk1 A G 7: 122,159,895 D118G probably benign Het
Ppat T C 5: 76,922,467 D168G possibly damaging Het
Preb T C 5: 30,958,505 E198G probably damaging Het
Psg21 T C 7: 18,652,453 T203A possibly damaging Het
Rbm17 A G 2: 11,598,131 V54A probably damaging Het
Rgma T A 7: 73,417,826 D276E probably damaging Het
Ric8a T C 7: 140,859,558 L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scarf1 A C 11: 75,526,028 E765D probably damaging Het
Sec14l4 G A 11: 4,040,041 M113I probably benign Het
Senp1 C T 15: 98,082,284 C60Y probably damaging Het
Slc22a21 T A 11: 53,951,304 K549N probably benign Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Spata13 T C 14: 60,709,555 M684T probably damaging Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Stag1 A G 9: 100,786,613 Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 V210E probably damaging Het
Tnc C T 4: 63,975,238 E1604K possibly damaging Het
Tspan31 T C 10: 127,068,496 D143G probably benign Het
Tspan5 T A 3: 138,898,142 Y131* probably null Het
Ttc21a A G 9: 119,966,123 D1070G probably damaging Het
Vmn2r26 C T 6: 124,039,749 P391S probably benign Het
Vmn2r72 A G 7: 85,738,256 I700T probably damaging Het
Vps13c A C 9: 67,913,820 N1204T probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Gm10184
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1521:Gm10184 UTSW 17 89910306 missense possibly damaging 0.85
R5638:Gm10184 UTSW 17 89910207 missense probably damaging 1.00
R7242:Gm10184 UTSW 17 89910135 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGCAATTTCCGAGCAGCTTGAG -3'
(R):5'- TCTGAGGGCTGAAGGGTAGC -3'

Sequencing Primer
(F):5'- CAGACCAATTTACAGTACCCTGGTTG -3'
(R):5'- CTGAAGGGTAGCAGACGTTTCC -3'
Posted On2014-10-30