Incidental Mutation 'R2327:Hirip3'
ID 245703
Institutional Source Beutler Lab
Gene Symbol Hirip3
Ensembl Gene ENSMUSG00000042606
Gene Name HIRA interacting protein 3
Synonyms
MMRRC Submission 040318-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2327 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 126461155-126464549 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126462038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 19 (R19G)
Ref Sequence ENSEMBL: ENSMUSP00000115145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037248] [ENSMUST00000050833] [ENSMUST00000071268] [ENSMUST00000106342] [ENSMUST00000106343] [ENSMUST00000132808] [ENSMUST00000205349] [ENSMUST00000129812] [ENSMUST00000206968] [ENSMUST00000206349] [ENSMUST00000214525]
AlphaFold Q8BLH7
Predicted Effect probably damaging
Transcript: ENSMUST00000037248
AA Change: R79G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035535
Gene: ENSMUSG00000042606
AA Change: R79G

DomainStartEndE-ValueType
low complexity region 96 113 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 229 244 N/A INTRINSIC
low complexity region 286 339 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 405 419 N/A INTRINSIC
internal_repeat_1 420 443 6.44e-5 PROSPERO
internal_repeat_1 440 463 6.44e-5 PROSPERO
CHZ 529 565 1.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050833
SMART Domains Protein: ENSMUSP00000049851
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 86 108 N/A INTRINSIC
low complexity region 116 132 N/A INTRINSIC
low complexity region 163 171 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071268
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106342
SMART Domains Protein: ENSMUSP00000101949
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 44 66 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106343
SMART Domains Protein: ENSMUSP00000101950
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
coiled coil region 10 55 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 125 147 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125624
Predicted Effect probably damaging
Transcript: ENSMUST00000132808
AA Change: R19G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115145
Gene: ENSMUSG00000042606
AA Change: R19G

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
low complexity region 88 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153764
Predicted Effect probably benign
Transcript: ENSMUST00000205349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154881
Predicted Effect probably benign
Transcript: ENSMUST00000129812
SMART Domains Protein: ENSMUSP00000114606
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
SCOP:d1iw7c_ 15 37 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205512
Predicted Effect probably benign
Transcript: ENSMUST00000206968
Predicted Effect probably benign
Transcript: ENSMUST00000206349
Predicted Effect probably benign
Transcript: ENSMUST00000205619
Predicted Effect probably benign
Transcript: ENSMUST00000214525
Meta Mutation Damage Score 0.1286 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The HIRA protein shares sequence similarity with Hir1p and Hir2p, the two corepressors of histone gene transcription characterized in the yeast, Saccharomyces cerevisiae. The structural features of the HIRA protein suggest that it may function as part of a multiprotein complex. Several cDNAs encoding HIRA-interacting proteins, or HIRIPs, have been identified. In vitro, the protein encoded by this gene binds HIRA, as well as H2B and H3 core histones, indicating that a complex containing HIRA-HIRIP3 could function in some aspects of chromatin and histone metabolism. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A T 14: 64,208,569 (GRCm39) probably null Het
Agbl4 T G 4: 111,383,798 (GRCm39) S218A probably benign Het
Apol11b T C 15: 77,522,153 (GRCm39) E48G probably damaging Het
Atp4a T A 7: 30,419,666 (GRCm39) N676K probably benign Het
Capn5 T A 7: 97,775,574 (GRCm39) S456C probably benign Het
Ccar1 T C 10: 62,600,161 (GRCm39) Y590C probably damaging Het
Ccdc188 G T 16: 18,037,070 (GRCm39) G283W probably damaging Het
Cd69 A G 6: 129,248,351 (GRCm39) V45A probably damaging Het
Col3a1 G T 1: 45,377,771 (GRCm39) probably benign Het
Cyb561a3 A T 19: 10,564,166 (GRCm39) T169S probably benign Het
Cyp2c39 A T 19: 39,527,397 (GRCm39) I248L probably benign Het
Cyp2j13 T C 4: 95,947,344 (GRCm39) T236A possibly damaging Het
Efs A G 14: 55,154,961 (GRCm39) V426A probably benign Het
Eme2 A G 17: 25,113,157 (GRCm39) L136S probably damaging Het
Fastkd1 T A 2: 69,535,872 (GRCm39) K312* probably null Het
Fbxl12 A G 9: 20,553,530 (GRCm39) L19P probably damaging Het
Flg2 T A 3: 93,110,913 (GRCm39) Y980* probably null Het
Fscn2 T A 11: 120,257,527 (GRCm39) I296N probably damaging Het
Gabrg3 A G 7: 56,384,835 (GRCm39) V242A probably benign Het
Galk2 A G 2: 125,817,315 (GRCm39) H368R probably damaging Het
Gm12695 C T 4: 96,657,893 (GRCm39) S92N probably benign Het
Gpalpp1 A T 14: 76,336,031 (GRCm39) S196T probably benign Het
Gpld1 A T 13: 25,168,804 (GRCm39) M773L probably benign Het
Haus8 A G 8: 71,708,289 (GRCm39) probably null Het
Inpp4a A G 1: 37,405,247 (GRCm39) T92A probably damaging Het
Irgm2 A G 11: 58,111,218 (GRCm39) D303G probably damaging Het
Kpna2rt C A 17: 90,217,697 (GRCm39) R16S probably benign Het
Krtap5-2 T G 7: 141,728,748 (GRCm39) S311R unknown Het
Krtdap T A 7: 30,489,185 (GRCm39) probably null Het
Lce1g G T 3: 92,658,140 (GRCm39) S56Y unknown Het
Lrrn1 G A 6: 107,545,794 (GRCm39) V531I probably benign Het
Mctp2 T C 7: 71,861,358 (GRCm39) E429G probably damaging Het
Mrgpra2b T G 7: 47,113,793 (GRCm39) D287A probably damaging Het
Mterf3 T C 13: 67,076,258 (GRCm39) T150A probably damaging Het
Mtus2 A G 5: 148,014,725 (GRCm39) N506S probably benign Het
Myh15 G T 16: 48,963,313 (GRCm39) V1085L probably benign Het
Myo9a A G 9: 59,687,048 (GRCm39) N51S probably benign Het
Nlrc3 A T 16: 3,771,304 (GRCm39) L196Q probably damaging Het
Nlrp9c T A 7: 26,074,747 (GRCm39) N816I probably damaging Het
Nsun2 T C 13: 69,767,700 (GRCm39) V218A probably benign Het
Nt5dc1 T C 10: 34,189,673 (GRCm39) E339G possibly damaging Het
Or10ak14 C T 4: 118,611,331 (GRCm39) V135I probably benign Het
Or51b6b A G 7: 103,309,779 (GRCm39) V226A probably damaging Het
Or8j3c A T 2: 86,253,165 (GRCm39) L285* probably null Het
Pik3ap1 A G 19: 41,284,828 (GRCm39) I619T probably damaging Het
Plk1 A G 7: 121,759,118 (GRCm39) D118G probably benign Het
Ppat T C 5: 77,070,314 (GRCm39) D168G possibly damaging Het
Preb T C 5: 31,115,849 (GRCm39) E198G probably damaging Het
Psg21 T C 7: 18,386,378 (GRCm39) T203A possibly damaging Het
Rbm17 A G 2: 11,602,942 (GRCm39) V54A probably damaging Het
Rgma T A 7: 73,067,574 (GRCm39) D276E probably damaging Het
Ric8a T C 7: 140,439,471 (GRCm39) L77P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Scarf1 A C 11: 75,416,854 (GRCm39) E765D probably damaging Het
Scart1 A T 7: 139,803,890 (GRCm39) N363Y possibly damaging Het
Sec14l4 G A 11: 3,990,041 (GRCm39) M113I probably benign Het
Senp1 C T 15: 97,980,165 (GRCm39) C60Y probably damaging Het
Slc22a21 T A 11: 53,842,130 (GRCm39) K549N probably benign Het
Slc39a10 T C 1: 46,875,156 (GRCm39) S49G probably damaging Het
Spata13 T C 14: 60,947,004 (GRCm39) M684T probably damaging Het
Spns1 T C 7: 125,969,958 (GRCm39) T481A probably damaging Het
Stag1 A G 9: 100,668,666 (GRCm39) Y198C possibly damaging Het
Tgfbr1 T A 4: 47,402,833 (GRCm39) V210E probably damaging Het
Tnc C T 4: 63,893,475 (GRCm39) E1604K possibly damaging Het
Tspan31 T C 10: 126,904,365 (GRCm39) D143G probably benign Het
Tspan5 T A 3: 138,603,903 (GRCm39) Y131* probably null Het
Ttc21a A G 9: 119,795,189 (GRCm39) D1070G probably damaging Het
Vmn2r26 C T 6: 124,016,708 (GRCm39) P391S probably benign Het
Vmn2r72 A G 7: 85,387,464 (GRCm39) I700T probably damaging Het
Vps13c A C 9: 67,821,102 (GRCm39) N1204T probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Other mutations in Hirip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Hirip3 APN 7 126,461,876 (GRCm39) missense probably damaging 1.00
IGL01531:Hirip3 APN 7 126,462,548 (GRCm39) missense possibly damaging 0.72
IGL01885:Hirip3 APN 7 126,463,381 (GRCm39) missense probably benign 0.00
R0126:Hirip3 UTSW 7 126,462,614 (GRCm39) missense probably damaging 0.99
R0270:Hirip3 UTSW 7 126,462,363 (GRCm39) missense probably damaging 0.99
R1185:Hirip3 UTSW 7 126,462,832 (GRCm39) frame shift probably null
R1185:Hirip3 UTSW 7 126,462,832 (GRCm39) frame shift probably null
R1185:Hirip3 UTSW 7 126,462,832 (GRCm39) frame shift probably null
R1676:Hirip3 UTSW 7 126,462,647 (GRCm39) splice site probably null
R1792:Hirip3 UTSW 7 126,461,792 (GRCm39) missense probably damaging 0.98
R1951:Hirip3 UTSW 7 126,462,038 (GRCm39) missense probably damaging 0.96
R4674:Hirip3 UTSW 7 126,463,834 (GRCm39) critical splice donor site probably null
R5024:Hirip3 UTSW 7 126,463,661 (GRCm39) splice site probably null
R5523:Hirip3 UTSW 7 126,463,034 (GRCm39) missense possibly damaging 0.62
R6876:Hirip3 UTSW 7 126,463,321 (GRCm39) missense probably damaging 1.00
R7181:Hirip3 UTSW 7 126,463,235 (GRCm39) missense probably damaging 1.00
R8208:Hirip3 UTSW 7 126,463,595 (GRCm39) missense probably damaging 1.00
R8378:Hirip3 UTSW 7 126,462,757 (GRCm39) missense probably benign 0.00
R9211:Hirip3 UTSW 7 126,463,567 (GRCm39) nonsense probably null
R9682:Hirip3 UTSW 7 126,462,021 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGGATCATCTTGAACCTGAAGAG -3'
(R):5'- AGCTGGTTCCTGACTCACTG -3'

Sequencing Primer
(F):5'- TCATCTTGAACCTGAAGAGAAGCAG -3'
(R):5'- TGACTCACTGTCCCCCAAG -3'
Posted On 2014-10-30