Incidental Mutation 'R2377:Olfr142'
ID248303
Institutional Source Beutler Lab
Gene Symbol Olfr142
Ensembl Gene ENSMUSG00000075063
Gene Nameolfactory receptor 142
SynonymsGA_x6K02T2Q125-51607674-51606757, K20, MOR227-2
MMRRC Submission 040354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2377 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90250130-90257592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90252911 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 26 (F26L)
Ref Sequence ENSEMBL: ENSMUSP00000150216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]
Predicted Effect probably damaging
Transcript: ENSMUST00000099752
AA Change: F26L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: F26L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 300 3e-6 PFAM
Pfam:7tm_1 39 285 5.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213968
AA Change: F26L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,467,923 D1304G probably damaging Het
Adamts10 C A 17: 33,528,892 H101N probably damaging Het
Apaf1 T A 10: 91,079,893 K44N possibly damaging Het
Aqr A T 2: 114,140,940 N471K possibly damaging Het
Blvrb T A 7: 27,459,599 I94N probably damaging Het
Ccdc38 C T 10: 93,574,035 P239S probably damaging Het
Chst4 T A 8: 110,030,172 Y270F possibly damaging Het
Col5a1 T C 2: 27,928,177 F138S unknown Het
Dhx32 G T 7: 133,724,478 H407N probably damaging Het
Dock3 G A 9: 106,895,891 P388S probably damaging Het
Fbxo10 A C 4: 45,044,719 Y639D probably benign Het
Fsip2 A G 2: 82,976,249 T971A probably benign Het
Gli2 C T 1: 118,837,125 A1099T possibly damaging Het
Hr C T 14: 70,557,878 L317F probably damaging Het
Ice1 G A 13: 70,602,780 A1729V probably damaging Het
Mcc C G 18: 44,519,549 K269N probably damaging Het
Miga2 T A 2: 30,383,990 C83* probably null Het
Msl1 A G 11: 98,803,963 R273G probably damaging Het
Msl3l2 T C 10: 56,115,563 I128T probably damaging Het
Ntrk1 T A 3: 87,791,407 D109V possibly damaging Het
Olfr126 A G 17: 37,850,607 N5S probably damaging Het
Olfr1307 A T 2: 111,944,643 L271Q probably damaging Het
Olfr1447 T A 19: 12,900,853 Y309F possibly damaging Het
Pcmtd2 A G 2: 181,855,279 probably benign Het
Polr1a T C 6: 71,972,826 probably null Het
Ptk2b T A 14: 66,172,548 I452F possibly damaging Het
Rad21 A G 15: 51,968,438 F416L probably damaging Het
Scn5a A T 9: 119,539,727 I244N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Tnpo3 A C 6: 29,579,619 N258K probably benign Het
Uba6 T C 5: 86,124,370 D789G possibly damaging Het
Vmn1r226 T G 17: 20,687,730 L75V probably benign Het
Zfp729b A C 13: 67,591,701 V815G possibly damaging Het
Other mutations in Olfr142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01623:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01810:Olfr142 APN 2 90252132 nonsense probably null
IGL01918:Olfr142 APN 2 90252331 missense probably damaging 1.00
IGL02619:Olfr142 APN 2 90252505 missense probably damaging 0.97
IGL02732:Olfr142 APN 2 90252308 missense probably damaging 1.00
IGL02738:Olfr142 APN 2 90252355 missense possibly damaging 0.82
IGL02795:Olfr142 APN 2 90252562 missense probably damaging 1.00
IGL02830:Olfr142 APN 2 90252781 missense probably damaging 1.00
R0601:Olfr142 UTSW 2 90252934 missense probably benign 0.05
R2004:Olfr142 UTSW 2 90252692 missense probably benign 0.04
R2136:Olfr142 UTSW 2 90252253 missense probably damaging 0.98
R3615:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3616:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3777:Olfr142 UTSW 2 90252625 missense probably damaging 1.00
R4763:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R4765:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R5421:Olfr142 UTSW 2 90252745 missense probably benign 0.01
R5426:Olfr142 UTSW 2 90252611 nonsense probably null
R6063:Olfr142 UTSW 2 90252427 missense probably benign 0.40
R6717:Olfr142 UTSW 2 90252524 missense probably benign 0.00
R6931:Olfr142 UTSW 2 90252777 nonsense probably null
R6936:Olfr142 UTSW 2 90252334 missense probably benign 0.17
R7013:Olfr142 UTSW 2 90252097 missense possibly damaging 0.87
R7091:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R7247:Olfr142 UTSW 2 90252821 missense probably damaging 1.00
R8169:Olfr142 UTSW 2 90252098 nonsense probably null
R8345:Olfr142 UTSW 2 90252217 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAGACAGCCCTTCAGAGAGATG -3'
(R):5'- AAACAGTCTGAGCTTTTGGGAG -3'

Sequencing Primer
(F):5'- CAGCCCTTCAGAGAGATGGTTTTAAC -3'
(R):5'- GGGAGTGCTTTTAGTGAAGTTAAC -3'
Posted On2014-11-11