Mutagenetix > Incidental Mutation

Incidental Mutation 'R2377:Aqr'

248305

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

040354-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2377 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113931642-114005788 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113971421 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 471 (N471K)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043160
AA Change: N471K

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: N471K

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102543
AA Change: N471K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: N471K

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126701

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	A	G	16: 14,285,787 (GRCm39)	D1304G	probably damaging	Het
Adamts10	C	A	17: 33,747,866 (GRCm39)	H101N	probably damaging	Het
Apaf1	T	A	10: 90,915,755 (GRCm39)	K44N	possibly damaging	Het
Blvrb	T	A	7: 27,159,024 (GRCm39)	I94N	probably damaging	Het
Ccdc38	C	T	10: 93,409,897 (GRCm39)	P239S	probably damaging	Het
Chst4	T	A	8: 110,756,804 (GRCm39)	Y270F	possibly damaging	Het
Col5a1	T	C	2: 27,818,189 (GRCm39)	F138S	unknown	Het
Dhx32	G	T	7: 133,326,207 (GRCm39)	H407N	probably damaging	Het
Dock3	G	A	9: 106,773,090 (GRCm39)	P388S	probably damaging	Het
Fbxo10	A	C	4: 45,044,719 (GRCm39)	Y639D	probably benign	Het
Fsip2	A	G	2: 82,806,593 (GRCm39)	T971A	probably benign	Het
Gli2	C	T	1: 118,764,855 (GRCm39)	A1099T	possibly damaging	Het
Hr	C	T	14: 70,795,318 (GRCm39)	L317F	probably damaging	Het
Ice1	G	A	13: 70,750,899 (GRCm39)	A1729V	probably damaging	Het
Mcc	C	G	18: 44,652,616 (GRCm39)	K269N	probably damaging	Het
Miga2	T	A	2: 30,274,002 (GRCm39)	C83*	probably null	Het
Msl1	A	G	11: 98,694,789 (GRCm39)	R273G	probably damaging	Het
Msl3l2	T	C	10: 55,991,659 (GRCm39)	I128T	probably damaging	Het
Ntrk1	T	A	3: 87,698,714 (GRCm39)	D109V	possibly damaging	Het
Or14j5	A	G	17: 38,161,498 (GRCm39)	N5S	probably damaging	Het
Or4b13	A	G	2: 90,083,255 (GRCm39)	F26L	probably damaging	Het
Or4f14b	A	T	2: 111,774,988 (GRCm39)	L271Q	probably damaging	Het
Or5b97	T	A	19: 12,878,217 (GRCm39)	Y309F	possibly damaging	Het
Pcmtd2	A	G	2: 181,497,072 (GRCm39)		probably benign	Het
Polr1a	T	C	6: 71,949,810 (GRCm39)		probably null	Het
Ptk2b	T	A	14: 66,409,997 (GRCm39)	I452F	possibly damaging	Het
Rad21	A	G	15: 51,831,834 (GRCm39)	F416L	probably damaging	Het
Scn5a	A	T	9: 119,368,793 (GRCm39)	I244N	probably damaging	Het
Sla2	G	A	2: 156,717,862 (GRCm39)	R137C	probably damaging	Het
Tnpo3	A	C	6: 29,579,618 (GRCm39)	N258K	probably benign	Het
Uba6	T	C	5: 86,272,229 (GRCm39)	D789G	possibly damaging	Het
Vmn1r226	T	G	17: 20,907,992 (GRCm39)	L75V	probably benign	Het
Zfp729b	A	C	13: 67,739,820 (GRCm39)	V815G	possibly damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	113,956,423 (GRCm39)	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	113,982,006 (GRCm39)	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	113,950,508 (GRCm39)	nonsense	probably null
IGL02297:Aqr	APN	2	113,980,962 (GRCm39)	missense	probably benign	0.24
IGL02380:Aqr	APN	2	113,940,417 (GRCm39)	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	113,967,398 (GRCm39)	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	113,949,261 (GRCm39)	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	113,943,127 (GRCm39)	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	113,943,835 (GRCm39)	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	113,965,305 (GRCm39)	splice site	probably benign
IGL03001:Aqr	APN	2	113,977,400 (GRCm39)	missense	probably benign
IGL03092:Aqr	APN	2	113,989,424 (GRCm39)	missense	probably benign	0.38
IGL03222:Aqr	APN	2	113,951,737 (GRCm39)	missense	probably damaging	1.00
capricorn	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
Goat	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
Pliades	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
sagittarius	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
Zodiac	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	113,961,215 (GRCm39)	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	113,989,491 (GRCm39)	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114,000,533 (GRCm39)	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	113,988,085 (GRCm39)	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	113,961,092 (GRCm39)	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	113,963,457 (GRCm39)	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	113,961,085 (GRCm39)	missense	probably benign	0.00
R0685:Aqr	UTSW	2	113,971,458 (GRCm39)	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	113,947,136 (GRCm39)	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	113,980,890 (GRCm39)	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	113,992,133 (GRCm39)	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	113,967,485 (GRCm39)	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	113,961,015 (GRCm39)	critical splice donor site	probably null
R2862:Aqr	UTSW	2	113,967,398 (GRCm39)	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	113,967,368 (GRCm39)	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R3715:Aqr	UTSW	2	113,949,150 (GRCm39)	splice site	probably benign
R4586:Aqr	UTSW	2	113,943,058 (GRCm39)	missense	probably benign	0.06
R4663:Aqr	UTSW	2	113,992,147 (GRCm39)	nonsense	probably null
R4809:Aqr	UTSW	2	114,005,695 (GRCm39)	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	113,980,990 (GRCm39)	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	113,940,418 (GRCm39)	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	113,943,832 (GRCm39)	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114,000,506 (GRCm39)	critical splice donor site	probably null
R5050:Aqr	UTSW	2	113,943,090 (GRCm39)	nonsense	probably null
R5213:Aqr	UTSW	2	113,943,808 (GRCm39)	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	113,947,059 (GRCm39)	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	113,988,056 (GRCm39)	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	113,963,554 (GRCm39)	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	113,979,451 (GRCm39)	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	113,979,515 (GRCm39)	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	113,986,746 (GRCm39)	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	113,957,442 (GRCm39)	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	113,973,530 (GRCm39)	nonsense	probably null
R6015:Aqr	UTSW	2	114,005,646 (GRCm39)	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	113,986,758 (GRCm39)	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	113,940,445 (GRCm39)	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	113,979,477 (GRCm39)	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	113,947,052 (GRCm39)	nonsense	probably null
R7211:Aqr	UTSW	2	113,965,204 (GRCm39)	missense	probably benign	0.01
R7232:Aqr	UTSW	2	113,936,363 (GRCm39)	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	113,934,543 (GRCm39)	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	113,950,427 (GRCm39)	nonsense	probably null
R7490:Aqr	UTSW	2	113,989,349 (GRCm39)	critical splice donor site	probably null
R7526:Aqr	UTSW	2	113,938,590 (GRCm39)	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	113,945,074 (GRCm39)	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	113,979,497 (GRCm39)	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	113,992,161 (GRCm39)	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	113,943,806 (GRCm39)	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	113,949,358 (GRCm39)	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	113,967,474 (GRCm39)	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	113,934,528 (GRCm39)	missense	probably benign	0.04
R9527:Aqr	UTSW	2	113,932,037 (GRCm39)	missense	probably benign	0.02
R9664:Aqr	UTSW	2	113,971,396 (GRCm39)	nonsense	probably null
Z1176:Aqr	UTSW	2	113,940,472 (GRCm39)	missense	probably benign	0.25
Z1176:Aqr	UTSW	2	113,938,603 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCAAATAGGAGGTATCTTTGGCAG -3'
(R):5'- TCCGTGCAAATGGAAAATGTG -3'

Sequencing Primer
(F):5'- GGCAGATATCTTCATACTGCTAAC -3'
(R):5'- GAGATGTGTCTGCTCCACAG -3'

Posted On

2014-11-11