Mutagenetix > Incidental Mutations

Incidental Mutation 'R3237:Lipn'

259122

Institutional Source

Beutler Lab

Gene Symbol

Lipn

Ensembl Gene

ENSMUSG00000024770

Gene Name

lipase, family member N

Synonyms

2210418G03Rik, Lipl4

MMRRC Submission

040619-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3237 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34067358-34084918 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34068738 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 37 (N37S)

Ref Sequence

ENSEMBL: ENSMUSP00000120184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]

Predicted Effect

probably benign
Transcript: ENSMUST00000025682
AA Change: N37S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: N37S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Abhydro_lipase	38	100	1.4e-22	PFAM
Pfam:Abhydrolase_5	81	376	1.6e-10	PFAM
Pfam:Abhydrolase_1	81	382	1.2e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117028

Predicted Effect

probably benign
Transcript: ENSMUST00000126710
AA Change: N37S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770
AA Change: N37S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Abhydro_lipase	38	100	6.4e-23	PFAM
Pfam:Abhydrolase_1	114	181	4.4e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148821
AA Change: N37S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770
AA Change: N37S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Abhydro_lipase	38	83	2.6e-15	PFAM

Meta Mutation Damage Score

0.3424

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aff2	T	A	X: 69,863,937	V1175E	possibly damaging	Het
Agbl3	A	G	6: 34,823,087		probably null	Het
Bcar3	C	A	3: 122,524,996	Q678K	probably benign	Het
Ccm2	G	A	11: 6,570,090	V53I	probably benign	Het
Cd3e	G	T	9: 45,002,310	C42*	probably null	Het
Cd4	A	T	6: 124,867,670	I384N	probably benign	Het
Ceacam11	T	A	7: 17,973,454	F54L	probably benign	Het
Cfap46	A	G	7: 139,617,590	S2122P	probably damaging	Het
Clptm1	A	G	7: 19,635,346	S461P	probably damaging	Het
Dlat	T	C	9: 50,638,031	T518A	possibly damaging	Het
Dnah17	T	C	11: 118,094,854	T1466A	probably benign	Het
Dnah9	G	A	11: 65,954,989	T3023I	probably benign	Het
Fam181a	T	G	12: 103,316,089	C84W	possibly damaging	Het
Fam198a	C	T	9: 121,964,869	P30S	possibly damaging	Het
H2-Q6	C	A	17: 35,425,700	T155K	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Inpp5b	A	G	4: 124,780,486	R329G	probably benign	Het
Klrb1f	A	T	6: 129,054,343	I168L	possibly damaging	Het
Lama4	A	T	10: 39,097,179	I1581F	probably damaging	Het
Lyzl4	T	C	9: 121,584,167	D65G	probably benign	Het
Med29	A	G	7: 28,392,621		probably benign	Het
Myrip	C	A	9: 120,441,407	D574E	possibly damaging	Het
N4bp3	A	T	11: 51,645,934	F104Y	probably damaging	Het
Nlrp9a	A	T	7: 26,571,385	K892*	probably null	Het
Nsd1	T	A	13: 55,312,888	H2309Q	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Optn	T	C	2: 5,034,203	S370G	probably damaging	Het
Pbrm1	T	C	14: 31,032,475	F151L	probably damaging	Het
Plekhs1	A	T	19: 56,464,600		probably null	Het
Rpn1	A	G	6: 88,103,414	K565R	probably benign	Het
Rrh	T	C	3: 129,811,711	Y110C	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr1	C	T	7: 29,069,650		probably null	Het
Scai	C	T	2: 39,150,314		probably benign	Het
Scap	C	G	9: 110,379,582	P564A	probably damaging	Het
Setdb1	A	G	3: 95,338,754	V619A	probably damaging	Het
Slc41a3	T	C	6: 90,636,865	Y226H	probably benign	Het
Slf2	A	G	19: 44,942,334	I617V	probably benign	Het
Sned1	G	A	1: 93,259,003	R180Q	probably benign	Het
Spata22	T	A	11: 73,345,887	F340I	probably damaging	Het
St8sia3	T	C	18: 64,269,815	F175S	probably damaging	Het
Supt20	T	C	3: 54,709,080	S253P	possibly damaging	Het
Syngap1	T	A	17: 26,957,093	Y118*	probably null	Het
Szt2	A	C	4: 118,383,034		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Uba3	G	T	6: 97,186,240	T319K	probably damaging	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zc3hav1	A	G	6: 38,319,715	L751S	probably damaging	Het
Zfp804b	T	C	5: 6,769,239	M1275V	probably benign	Het
Zgrf1	A	G	3: 127,613,375	D1597G	probably damaging	Het

Other mutations in Lipn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01288:Lipn	APN	19	34079035	missense	probably benign	0.06
IGL01320:Lipn	APN	19	34084640	missense	probably benign	0.07
IGL01827:Lipn	APN	19	34069480	missense	probably damaging	1.00
IGL02252:Lipn	APN	19	34071757	missense	probably benign	0.01
IGL02422:Lipn	APN	19	34068663	missense	probably benign	0.00
R0081:Lipn	UTSW	19	34076976	missense	probably benign	0.00
R0284:Lipn	UTSW	19	34080706	missense	possibly damaging	0.87
R0539:Lipn	UTSW	19	34084603	unclassified	probably benign
R0749:Lipn	UTSW	19	34076979	missense	probably damaging	1.00
R1170:Lipn	UTSW	19	34071758	missense	probably benign	0.23
R1528:Lipn	UTSW	19	34068670	missense	probably damaging	0.96
R1621:Lipn	UTSW	19	34068713	missense	probably benign
R1675:Lipn	UTSW	19	34080710	missense	probably damaging	1.00
R1869:Lipn	UTSW	19	34080739	missense	possibly damaging	0.93
R3236:Lipn	UTSW	19	34068738	missense	probably benign	0.17
R3832:Lipn	UTSW	19	34069533	critical splice donor site	probably null
R3876:Lipn	UTSW	19	34069428	missense	probably benign	0.00
R4084:Lipn	UTSW	19	34078940	missense	probably benign	0.04
R4595:Lipn	UTSW	19	34081350	missense	probably damaging	1.00
R5963:Lipn	UTSW	19	34081300	missense	probably damaging	0.97
R6018:Lipn	UTSW	19	34076935	missense	probably damaging	1.00
R6797:Lipn	UTSW	19	34080760	missense	probably benign
R7090:Lipn	UTSW	19	34071780	missense	possibly damaging	0.72
R7157:Lipn	UTSW	19	34076990	nonsense	probably null
R7458:Lipn	UTSW	19	34071842	missense	probably benign	0.10
R8824:Lipn	UTSW	19	34084716	missense	probably benign	0.04
R8894:Lipn	UTSW	19	34084848	makesense	probably null
R8933:Lipn	UTSW	19	34069480	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CACACTCACTGCGTTGGATG -3'
(R):5'- GTTCCATGCCAATAGAATTCTGTC -3'

Sequencing Primer
(F):5'- CACTGCGTTGGATGAATAAGACTCC -3'
(R):5'- TCTGTCATGAAATATCCAAATGGG -3'

Posted On

2015-01-23