Incidental Mutation 'R3237:Lipn'
ID259122
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Namelipase, family member N
Synonyms2210418G03Rik, Lipl4
MMRRC Submission 040619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3237 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34067358-34084918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34068738 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 37 (N37S)
Ref Sequence ENSEMBL: ENSMUSP00000120184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]
Predicted Effect probably benign
Transcript: ENSMUST00000025682
AA Change: N37S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: N37S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117028
Predicted Effect probably benign
Transcript: ENSMUST00000126710
AA Change: N37S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770
AA Change: N37S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 6.4e-23 PFAM
Pfam:Abhydrolase_1 114 181 4.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
AA Change: N37S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770
AA Change: N37S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Meta Mutation Damage Score 0.3424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccm2 G A 11: 6,570,090 V53I probably benign Het
Cd3e G T 9: 45,002,310 C42* probably null Het
Cd4 A T 6: 124,867,670 I384N probably benign Het
Ceacam11 T A 7: 17,973,454 F54L probably benign Het
Cfap46 A G 7: 139,617,590 S2122P probably damaging Het
Clptm1 A G 7: 19,635,346 S461P probably damaging Het
Dlat T C 9: 50,638,031 T518A possibly damaging Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Fam181a T G 12: 103,316,089 C84W possibly damaging Het
Fam198a C T 9: 121,964,869 P30S possibly damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Inpp5b A G 4: 124,780,486 R329G probably benign Het
Klrb1f A T 6: 129,054,343 I168L possibly damaging Het
Lama4 A T 10: 39,097,179 I1581F probably damaging Het
Lyzl4 T C 9: 121,584,167 D65G probably benign Het
Med29 A G 7: 28,392,621 probably benign Het
Myrip C A 9: 120,441,407 D574E possibly damaging Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Nlrp9a A T 7: 26,571,385 K892* probably null Het
Nsd1 T A 13: 55,312,888 H2309Q possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Optn T C 2: 5,034,203 S370G probably damaging Het
Pbrm1 T C 14: 31,032,475 F151L probably damaging Het
Plekhs1 A T 19: 56,464,600 probably null Het
Rpn1 A G 6: 88,103,414 K565R probably benign Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr1 C T 7: 29,069,650 probably null Het
Scai C T 2: 39,150,314 probably benign Het
Scap C G 9: 110,379,582 P564A probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Slc41a3 T C 6: 90,636,865 Y226H probably benign Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Sned1 G A 1: 93,259,003 R180Q probably benign Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
St8sia3 T C 18: 64,269,815 F175S probably damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Syngap1 T A 17: 26,957,093 Y118* probably null Het
Szt2 A C 4: 118,383,034 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba3 G T 6: 97,186,240 T319K probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zc3hav1 A G 6: 38,319,715 L751S probably damaging Het
Zfp804b T C 5: 6,769,239 M1275V probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34079035 missense probably benign 0.06
IGL01320:Lipn APN 19 34084640 missense probably benign 0.07
IGL01827:Lipn APN 19 34069480 missense probably damaging 1.00
IGL02252:Lipn APN 19 34071757 missense probably benign 0.01
IGL02422:Lipn APN 19 34068663 missense probably benign 0.00
R0081:Lipn UTSW 19 34076976 missense probably benign 0.00
R0284:Lipn UTSW 19 34080706 missense possibly damaging 0.87
R0539:Lipn UTSW 19 34084603 unclassified probably benign
R0749:Lipn UTSW 19 34076979 missense probably damaging 1.00
R1170:Lipn UTSW 19 34071758 missense probably benign 0.23
R1528:Lipn UTSW 19 34068670 missense probably damaging 0.96
R1621:Lipn UTSW 19 34068713 missense probably benign
R1675:Lipn UTSW 19 34080710 missense probably damaging 1.00
R1869:Lipn UTSW 19 34080739 missense possibly damaging 0.93
R3236:Lipn UTSW 19 34068738 missense probably benign 0.17
R3832:Lipn UTSW 19 34069533 critical splice donor site probably null
R3876:Lipn UTSW 19 34069428 missense probably benign 0.00
R4084:Lipn UTSW 19 34078940 missense probably benign 0.04
R4595:Lipn UTSW 19 34081350 missense probably damaging 1.00
R5963:Lipn UTSW 19 34081300 missense probably damaging 0.97
R6018:Lipn UTSW 19 34076935 missense probably damaging 1.00
R6797:Lipn UTSW 19 34080760 missense probably benign
R7090:Lipn UTSW 19 34071780 missense possibly damaging 0.72
R7157:Lipn UTSW 19 34076990 nonsense probably null
R7458:Lipn UTSW 19 34071842 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CACACTCACTGCGTTGGATG -3'
(R):5'- GTTCCATGCCAATAGAATTCTGTC -3'

Sequencing Primer
(F):5'- CACTGCGTTGGATGAATAAGACTCC -3'
(R):5'- TCTGTCATGAAATATCCAAATGGG -3'
Posted On2015-01-23