Incidental Mutation 'R3237:Vmn2r112'
ID259117
Institutional Source Beutler Lab
Gene Symbol Vmn2r112
Ensembl Gene ENSMUSG00000094921
Gene Namevomeronasal 2, receptor 112
SynonymsEG628185
MMRRC Submission 040619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R3237 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location22601148-22619133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22603115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 258 (V258E)
Ref Sequence ENSEMBL: ENSMUSP00000094994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097381]
Predicted Effect probably damaging
Transcript: ENSMUST00000097381
AA Change: V258E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: V258E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.8e-32 PFAM
Pfam:NCD3G 512 565 5.8e-21 PFAM
Pfam:7tm_3 598 833 6.5e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccm2 G A 11: 6,570,090 V53I probably benign Het
Cd3e G T 9: 45,002,310 C42* probably null Het
Cd4 A T 6: 124,867,670 I384N probably benign Het
Ceacam11 T A 7: 17,973,454 F54L probably benign Het
Cfap46 A G 7: 139,617,590 S2122P probably damaging Het
Clptm1 A G 7: 19,635,346 S461P probably damaging Het
Dlat T C 9: 50,638,031 T518A possibly damaging Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Fam181a T G 12: 103,316,089 C84W possibly damaging Het
Fam198a C T 9: 121,964,869 P30S possibly damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Inpp5b A G 4: 124,780,486 R329G probably benign Het
Klrb1f A T 6: 129,054,343 I168L possibly damaging Het
Lama4 A T 10: 39,097,179 I1581F probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lyzl4 T C 9: 121,584,167 D65G probably benign Het
Med29 A G 7: 28,392,621 probably benign Het
Myrip C A 9: 120,441,407 D574E possibly damaging Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Nlrp9a A T 7: 26,571,385 K892* probably null Het
Nsd1 T A 13: 55,312,888 H2309Q possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Optn T C 2: 5,034,203 S370G probably damaging Het
Pbrm1 T C 14: 31,032,475 F151L probably damaging Het
Plekhs1 A T 19: 56,464,600 probably null Het
Rpn1 A G 6: 88,103,414 K565R probably benign Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr1 C T 7: 29,069,650 probably null Het
Scai C T 2: 39,150,314 probably benign Het
Scap C G 9: 110,379,582 P564A probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Slc41a3 T C 6: 90,636,865 Y226H probably benign Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Sned1 G A 1: 93,259,003 R180Q probably benign Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
St8sia3 T C 18: 64,269,815 F175S probably damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Syngap1 T A 17: 26,957,093 Y118* probably null Het
Szt2 A C 4: 118,383,034 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba3 G T 6: 97,186,240 T319K probably damaging Het
Zc3hav1 A G 6: 38,319,715 L751S probably damaging Het
Zfp804b T C 5: 6,769,239 M1275V probably benign Het
Zgrf1 A G 3: 127,613,375 D1597G probably damaging Het
Other mutations in Vmn2r112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Vmn2r112 APN 17 22618936 missense probably benign 0.13
IGL01021:Vmn2r112 APN 17 22618904 missense probably damaging 1.00
IGL01122:Vmn2r112 APN 17 22603007 missense probably benign 0.00
IGL01360:Vmn2r112 APN 17 22618622 missense probably benign 0.03
IGL01536:Vmn2r112 APN 17 22605155 missense probably damaging 1.00
IGL02148:Vmn2r112 APN 17 22619032 missense probably damaging 1.00
IGL02465:Vmn2r112 APN 17 22614994 missense probably damaging 1.00
PIT4576001:Vmn2r112 UTSW 17 22614931 missense probably benign 0.00
R0278:Vmn2r112 UTSW 17 22603006 missense probably benign 0.44
R0328:Vmn2r112 UTSW 17 22605270 missense probably benign 0.01
R0583:Vmn2r112 UTSW 17 22618949 missense probably damaging 1.00
R0831:Vmn2r112 UTSW 17 22614999 missense probably damaging 0.99
R1080:Vmn2r112 UTSW 17 22618999 missense probably damaging 1.00
R1245:Vmn2r112 UTSW 17 22603247 missense probably benign 0.03
R1321:Vmn2r112 UTSW 17 22618519 nonsense probably null
R1381:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R1514:Vmn2r112 UTSW 17 22602844 missense probably benign 0.40
R1519:Vmn2r112 UTSW 17 22618903 missense possibly damaging 0.83
R1572:Vmn2r112 UTSW 17 22603144 missense possibly damaging 0.61
R1590:Vmn2r112 UTSW 17 22615008 critical splice donor site probably null
R1640:Vmn2r112 UTSW 17 22605116 missense probably benign 0.01
R2221:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2223:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2310:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2312:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2337:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2339:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2340:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2341:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2342:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2401:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2860:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2861:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2926:Vmn2r112 UTSW 17 22615003 missense possibly damaging 0.90
R3236:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3977:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3979:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R4168:Vmn2r112 UTSW 17 22603088 missense probably benign 0.01
R4256:Vmn2r112 UTSW 17 22618412 missense probably damaging 1.00
R4386:Vmn2r112 UTSW 17 22601322 missense probably benign 0.36
R4912:Vmn2r112 UTSW 17 22603382 missense probably damaging 0.99
R4947:Vmn2r112 UTSW 17 22602879 missense probably benign 0.02
R5446:Vmn2r112 UTSW 17 22618250 missense probably damaging 1.00
R5870:Vmn2r112 UTSW 17 22619023 missense probably benign 0.00
R6351:Vmn2r112 UTSW 17 22601278 missense probably benign
R6384:Vmn2r112 UTSW 17 22605155 missense probably damaging 1.00
R6390:Vmn2r112 UTSW 17 22605249 missense probably benign 0.01
R6401:Vmn2r112 UTSW 17 22603551 nonsense probably null
R6405:Vmn2r112 UTSW 17 22618235 missense probably damaging 1.00
R6620:Vmn2r112 UTSW 17 22603101 missense probably benign 0.00
R6648:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R6649:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6653:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6654:Vmn2r112 UTSW 17 22603469 missense possibly damaging 0.89
R6700:Vmn2r112 UTSW 17 22603481 missense possibly damaging 0.53
R6993:Vmn2r112 UTSW 17 22603214 missense probably benign 0.01
R7052:Vmn2r112 UTSW 17 22602526 missense probably benign
R7454:Vmn2r112 UTSW 17 22603307 missense probably benign 0.00
R7763:Vmn2r112 UTSW 17 22603118 missense probably damaging 1.00
R8032:Vmn2r112 UTSW 17 22603394 missense probably benign 0.21
Z1088:Vmn2r112 UTSW 17 22605078 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCCTCTGATCATACATCTCTAGC -3'
(R):5'- GACTGAGTTCAATGTCTGCAC -3'

Sequencing Primer
(F):5'- GATCATACATCTCTAGCCCTTGC -3'
(R):5'- CCAGAAATCTCACTATTGTGTTGTTG -3'
Posted On2015-01-23