Incidental Mutation 'R6797:Lipn'
ID533079
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Namelipase, family member N
Synonyms2210418G03Rik, Lipl4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6797 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34067358-34084918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34080760 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 294 (M294L)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000148821]
Predicted Effect probably benign
Transcript: ENSMUST00000025682
AA Change: M294L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: M294L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c18 T A 13: 4,145,277 I61L probably benign Het
Angptl2 T C 2: 33,228,265 V17A probably benign Het
Casp14 T C 10: 78,715,141 D70G possibly damaging Het
Cckbr A G 7: 105,434,566 M234V possibly damaging Het
Cd93 T C 2: 148,442,124 N434S probably benign Het
Cenpe A T 3: 135,238,138 Q938L possibly damaging Het
Col6a3 A C 1: 90,804,088 V1481G probably damaging Het
Dnah5 G T 15: 28,233,238 E248* probably null Het
Dnah5 G A 15: 28,451,463 R4349Q probably damaging Het
F11 A G 8: 45,253,055 Y98H probably benign Het
Fam208b T C 13: 3,576,769 I1060M probably benign Het
Fen1 A G 19: 10,200,703 F126L probably benign Het
Gpr146 G A 5: 139,393,040 G199D possibly damaging Het
Gramd1b A G 9: 40,308,406 I324T probably benign Het
Hist1h2bk A T 13: 22,036,089 N68I probably benign Het
Hivep1 C A 13: 42,157,081 S932R probably benign Het
Hk3 A T 13: 55,010,831 probably null Het
Hspbp1 T A 7: 4,660,782 M355L possibly damaging Het
Jaml T C 9: 45,088,760 C77R probably damaging Het
Kmt2e A G 5: 23,482,507 N452D possibly damaging Het
Krt5 T C 15: 101,712,641 Y57C unknown Het
Magel2 A G 7: 62,380,159 E937G unknown Het
Med13l G A 5: 118,759,264 probably null Het
Mrgprb8 G A 7: 48,389,144 V188I probably benign Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Ofcc1 C T 13: 40,087,947 R695Q possibly damaging Het
Olfr598 G A 7: 103,329,121 V212I probably benign Het
Olfr748 T A 14: 50,711,106 Y259N probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pak7 A T 2: 136,097,534 H560Q probably damaging Het
Pigg T C 5: 108,332,828 S493P probably damaging Het
Ppp6r3 A G 19: 3,514,719 W185R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sacs T A 14: 61,213,073 D4189E probably damaging Het
Serpinb9b A G 13: 33,029,484 N8S possibly damaging Het
Slit3 A G 11: 35,633,952 T730A possibly damaging Het
Srgap3 A T 6: 112,829,542 F53I probably damaging Het
Stc2 T A 11: 31,365,351 K163* probably null Het
Tlk1 T A 2: 70,738,426 K411* probably null Het
Ttc27 G T 17: 74,729,888 L185F probably benign Het
Vmn2r102 C T 17: 19,660,432 Q12* probably null Het
Vmn2r95 C T 17: 18,452,289 probably benign Het
Vopp1 A G 6: 57,762,507 Y19H possibly damaging Het
Wdr64 T A 1: 175,810,610 probably null Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34079035 missense probably benign 0.06
IGL01320:Lipn APN 19 34084640 missense probably benign 0.07
IGL01827:Lipn APN 19 34069480 missense probably damaging 1.00
IGL02252:Lipn APN 19 34071757 missense probably benign 0.01
IGL02422:Lipn APN 19 34068663 missense probably benign 0.00
R0081:Lipn UTSW 19 34076976 missense probably benign 0.00
R0284:Lipn UTSW 19 34080706 missense possibly damaging 0.87
R0539:Lipn UTSW 19 34084603 unclassified probably benign
R0749:Lipn UTSW 19 34076979 missense probably damaging 1.00
R1170:Lipn UTSW 19 34071758 missense probably benign 0.23
R1528:Lipn UTSW 19 34068670 missense probably damaging 0.96
R1621:Lipn UTSW 19 34068713 missense probably benign
R1675:Lipn UTSW 19 34080710 missense probably damaging 1.00
R1869:Lipn UTSW 19 34080739 missense possibly damaging 0.93
R3236:Lipn UTSW 19 34068738 missense probably benign 0.17
R3237:Lipn UTSW 19 34068738 missense probably benign 0.17
R3832:Lipn UTSW 19 34069533 critical splice donor site probably null
R3876:Lipn UTSW 19 34069428 missense probably benign 0.00
R4084:Lipn UTSW 19 34078940 missense probably benign 0.04
R4595:Lipn UTSW 19 34081350 missense probably damaging 1.00
R5963:Lipn UTSW 19 34081300 missense probably damaging 0.97
R6018:Lipn UTSW 19 34076935 missense probably damaging 1.00
R7090:Lipn UTSW 19 34071780 missense possibly damaging 0.72
R7157:Lipn UTSW 19 34076990 nonsense probably null
R7458:Lipn UTSW 19 34071842 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTCACACAGAAGGTTTTGCTG -3'
(R):5'- TGGCATTGCTTTGTGTCACAC -3'

Sequencing Primer
(F):5'- GCTGACTTTTTCAAAGCACCAG -3'
(R):5'- ACCACAAAACTCTTTCTCTTGAAGTC -3'
Posted On2018-08-29