Incidental Mutation 'R2896:Pdcl'
ID260784
Institutional Source Beutler Lab
Gene Symbol Pdcl
Ensembl Gene ENSMUSG00000009030
Gene Namephosducin-like
Synonyms1200011E13Rik, PhLP1
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37350074-37359332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37355690 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 100 (D100E)
Ref Sequence ENSEMBL: ENSMUSP00000119372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009174] [ENSMUST00000112940] [ENSMUST00000138314] [ENSMUST00000147703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009174
AA Change: D100E

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009174
Gene: ENSMUSG00000009030
AA Change: D100E

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 299 8.6e-162 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112940
AA Change: D100E

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108562
Gene: ENSMUSG00000009030
AA Change: D100E

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 299 8.6e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138314
SMART Domains Protein: ENSMUSP00000145483
Gene: ENSMUSG00000009030

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147703
AA Change: D100E

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119372
Gene: ENSMUSG00000009030
AA Change: D100E

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 193 6.8e-90 PFAM
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosducin-like protein is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin, a phosphoprotein expressed in retina and pineal gland. Both phosducin-like protein and phosphoducin have been shown to regulate G-protein signaling by binding to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Spata18 T C 5: 73,657,802 S85P probably damaging Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Pdcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Pdcl APN 2 37357374 start codon destroyed probably null 1.00
BB003:Pdcl UTSW 2 37352237 missense probably damaging 1.00
BB003:Pdcl UTSW 2 37352239 missense probably damaging 1.00
BB013:Pdcl UTSW 2 37352237 missense probably damaging 1.00
BB013:Pdcl UTSW 2 37352239 missense probably damaging 1.00
R0019:Pdcl UTSW 2 37351920 missense probably damaging 0.99
R0019:Pdcl UTSW 2 37351920 missense probably damaging 0.99
R0147:Pdcl UTSW 2 37352130 missense probably benign 0.00
R0148:Pdcl UTSW 2 37352130 missense probably benign 0.00
R0157:Pdcl UTSW 2 37352177 missense probably damaging 1.00
R1876:Pdcl UTSW 2 37355696 missense probably damaging 0.99
R2202:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2203:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2204:Pdcl UTSW 2 37352044 missense probably benign 0.28
R3961:Pdcl UTSW 2 37352187 missense probably benign 0.00
R4010:Pdcl UTSW 2 37352111 missense probably damaging 1.00
R4663:Pdcl UTSW 2 37355766 missense probably damaging 1.00
R6896:Pdcl UTSW 2 37352179 missense probably damaging 1.00
R7926:Pdcl UTSW 2 37352237 missense probably damaging 1.00
R7926:Pdcl UTSW 2 37352239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACGTATAGCTGAGCTGAG -3'
(R):5'- GATGTCAGCTGGTCCAAAGC -3'

Sequencing Primer
(F):5'- TGCACCCCAAGTTATGACAGGG -3'
(R):5'- GGTCCAAAGCCCCTTGTCTG -3'
Posted On2015-01-23