Incidental Mutation 'R2896:Spata18'
ID260792
Institutional Source Beutler Lab
Gene Symbol Spata18
Ensembl Gene ENSMUSG00000029155
Gene Namespermatogenesis associated 18
Synonyms
MMRRC Submission 040484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R2896 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73651379-73679512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73657802 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000064308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041422] [ENSMUST00000071077] [ENSMUST00000113548] [ENSMUST00000178631]
Predicted Effect probably damaging
Transcript: ENSMUST00000041422
AA Change: S85P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040922
Gene: ENSMUSG00000029155
AA Change: S85P

DomainStartEndE-ValueType
coiled coil region 178 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071077
AA Change: S85P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064308
Gene: ENSMUSG00000029155
AA Change: S85P

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113548
SMART Domains Protein: ENSMUSP00000109176
Gene: ENSMUSG00000029155

DomainStartEndE-ValueType
Pfam:MIEAP 6 195 2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178631
SMART Domains Protein: ENSMUSP00000137444
Gene: ENSMUSG00000029155

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Pfam:MIEAP 296 485 1.2e-65 PFAM
Meta Mutation Damage Score 0.3551 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a p53-inducible protein that is able to induce lysosome-like organelles within mitochondria that eliminate oxidized mitochondrial proteins, thereby contributing to mitochondrial quality control. Dysregulation of mitochondrial quality control is associated with cancer and degenerative diseases. The encoded protein mediates accumulation of the lysosome-like mitochondrial organelles through interaction with B cell lymphoma 2 interacting protein 3 and B cell lymphoma 2 interacting protein 3 like at the outer mitochondrial membrane, which allows translocation of lysosomal proteins to the mitochondrial matrix from the cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homo- or heterozygous KO in mice also carrying one copy of the ApcMin allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Bpifb4 T G 2: 153,954,437 probably benign Het
Cachd1 T A 4: 100,970,903 L616Q probably damaging Het
Crebbp A G 16: 4,138,816 L381P probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Esp6 T A 17: 40,562,943 M7K possibly damaging Het
Fam83d G A 2: 158,785,978 R529Q probably damaging Het
Gm26526 T G 7: 39,589,013 noncoding transcript Het
Gm8374 T A 14: 7,364,200 R47* probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
Gss A G 2: 155,564,829 L342P probably damaging Het
Ighv1-67 T A 12: 115,603,975 T106S probably damaging Het
Kif21b T C 1: 136,154,217 Y668H possibly damaging Het
Lcmt1 A G 7: 123,421,586 R245G possibly damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Pdcl A T 2: 37,355,690 D100E possibly damaging Het
Phkg1 C A 5: 129,864,630 K326N possibly damaging Het
Prss1 G A 6: 41,463,705 W238* probably null Het
Rdh10 A T 1: 16,106,105 probably null Het
Ror1 T C 4: 100,096,280 L21P unknown Het
Skint8 A G 4: 111,950,136 I340V probably null Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Ttll3 G T 6: 113,392,722 A76S probably benign Het
Ttll4 T A 1: 74,685,358 H562Q possibly damaging Het
Ubn1 A G 16: 5,055,219 H35R possibly damaging Het
Ubr4 A G 4: 139,455,644 probably null Het
Zfp456 T C 13: 67,367,297 R97G possibly damaging Het
Other mutations in Spata18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Spata18 APN 5 73657754 missense possibly damaging 0.80
IGL01331:Spata18 APN 5 73669681 missense probably damaging 1.00
IGL01394:Spata18 APN 5 73679345 splice site probably null
IGL01994:Spata18 APN 5 73657601 critical splice donor site probably null
IGL02192:Spata18 APN 5 73672518 splice site probably null
IGL02253:Spata18 APN 5 73668596 missense possibly damaging 0.61
IGL03195:Spata18 APN 5 73671248 missense probably damaging 1.00
IGL03204:Spata18 APN 5 73671106 splice site probably benign
ANU74:Spata18 UTSW 5 73671113 missense probably damaging 1.00
R0312:Spata18 UTSW 5 73666881 missense probably benign 0.00
R0557:Spata18 UTSW 5 73651670 missense probably damaging 1.00
R1624:Spata18 UTSW 5 73669545 missense probably damaging 0.98
R1901:Spata18 UTSW 5 73671139 missense probably damaging 1.00
R1937:Spata18 UTSW 5 73676964 missense probably damaging 1.00
R2228:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2229:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R3082:Spata18 UTSW 5 73679080 intron probably benign
R3716:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R3717:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R4061:Spata18 UTSW 5 73671166 missense probably damaging 1.00
R4299:Spata18 UTSW 5 73666902 missense probably benign 0.36
R4963:Spata18 UTSW 5 73678993 missense probably damaging 0.96
R5603:Spata18 UTSW 5 73671232 missense probably benign 0.12
R6381:Spata18 UTSW 5 73675216 missense probably damaging 1.00
R6581:Spata18 UTSW 5 73669516 missense probably benign 0.14
R7062:Spata18 UTSW 5 73659293 missense probably benign 0.08
R7591:Spata18 UTSW 5 73672416 missense
R7682:Spata18 UTSW 5 73668665 missense
R7688:Spata18 UTSW 5 73651662 missense probably benign 0.14
R7783:Spata18 UTSW 5 73668610 missense
R8051:Spata18 UTSW 5 73669720 missense
X0061:Spata18 UTSW 5 73666859 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTTGGGATCCTCACAGTGACAG -3'
(R):5'- GCTAACACTGACCATTGAAAGTTAC -3'

Sequencing Primer
(F):5'- TCACAGTGACAGCCCAAGAAGG -3'
(R):5'- TTACCAGTGAGGACCCAGTG -3'
Posted On2015-01-23