Incidental Mutation 'R0294:Slc5a4b'
ID26303
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Namesolute carrier family 5 (neutral amino acid transporters, system A), member 4b
SynonymspSGLT2, SGLT3b, 2010104G07Rik, SAAT1
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0294 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76057494-76110961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76081327 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 292 (C292R)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
Predicted Effect probably damaging
Transcript: ENSMUST00000120757
AA Change: C292R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: C292R

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124320
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Dock8 T C 19: 25,188,350 I1866T probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Il5ra A T 6: 106,712,401 M410K probably benign Het
Ints7 A G 1: 191,611,891 S548G possibly damaging Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mgst2 A G 3: 51,681,830 Y88C probably damaging Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Nnt T A 13: 119,336,267 Y719F probably benign Het
Nnt T G 13: 119,338,417 I659L possibly damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr506 A T 7: 108,613,150 Y281F probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Sphkap T A 1: 83,278,245 E594D possibly damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 76070588 missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 76070495 splice site probably benign
IGL01754:Slc5a4b APN 10 76070615 missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 76060426 missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 76060354 missense probably benign 0.01
IGL02211:Slc5a4b APN 10 76060463 splice site probably benign
IGL02254:Slc5a4b APN 10 76060430 missense probably benign
IGL02389:Slc5a4b APN 10 76072465 nonsense probably null
IGL02427:Slc5a4b APN 10 76058879 missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 76075015 missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 76110851 missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 76075100 missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 76070628 missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 76062283 missense probably damaging 0.99
R0522:Slc5a4b UTSW 10 76090700 missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 76064036 missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 76081507 missense probably benign 0.09
R0975:Slc5a4b UTSW 10 76081407 missense probably benign 0.09
R1934:Slc5a4b UTSW 10 76081473 missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 76108549 missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 76075073 missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 76081524 missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 76062260 missense probably benign 0.01
R4012:Slc5a4b UTSW 10 76074992 missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 76058891 nonsense probably null
R4667:Slc5a4b UTSW 10 76075045 missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 76062239 missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 76081467 missense probably benign 0.44
R5181:Slc5a4b UTSW 10 76060387 nonsense probably null
R5319:Slc5a4b UTSW 10 76062399 missense probably benign 0.08
R6306:Slc5a4b UTSW 10 76081351 missense probably benign 0.01
R6422:Slc5a4b UTSW 10 76103862 missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 76062386 missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 76089978 missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 76075109 missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 76110908 missense probably benign 0.01
R7683:Slc5a4b UTSW 10 76064072 missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 76070573 missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 76062299 missense probably benign 0.19
R7877:Slc5a4b UTSW 10 76075052 missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 76103846 missense possibly damaging 0.93
X0019:Slc5a4b UTSW 10 76110851 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGATCCTGATTCGGTGTGTCACTCTAC -3'
(R):5'- CCGAGAAGTATATGAATGCCATCCCC -3'

Sequencing Primer
(F):5'- CTGAAAGAGCTGAATGTGTCTC -3'
(R):5'- GAATGCCATCCCCTCTGTAGTG -3'
Posted On2013-04-16