Incidental Mutation 'R8150:Slc5a4b'
ID632919
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Namesolute carrier family 5 (neutral amino acid transporters, system A), member 4b
SynonymspSGLT2, SGLT3b, 2010104G07Rik, SAAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R8150 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location76057494-76110961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76103846 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 152 (I152N)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120757
AA Change: I152N

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: I152N

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.5%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,533,824 M129L probably benign Het
Abca2 T C 2: 25,447,381 I2416T probably damaging Het
Abca3 A G 17: 24,396,548 D871G probably benign Het
Akap9 C T 5: 3,961,982 T895I probably damaging Het
Aldh8a1 A G 10: 21,395,545 E390G probably damaging Het
Ank2 T A 3: 126,947,513 D1574V Het
Blmh T C 11: 76,968,629 V352A probably benign Het
C130079G13Rik A G 3: 59,936,137 D84G probably damaging Het
Cacna1i T C 15: 80,375,339 L1270P probably damaging Het
Ccdc80 T A 16: 45,127,429 H923Q probably damaging Het
Cdc27 G A 11: 104,515,460 H610Y probably damaging Het
Cep126 T C 9: 8,101,790 I248V probably benign Het
Ces5a T C 8: 93,530,802 N125S probably damaging Het
Chd3 G A 11: 69,363,684 H201Y probably benign Het
Cpeb1 T C 7: 81,357,404 T292A probably damaging Het
Gli2 G A 1: 118,835,828 T1531I probably damaging Het
Gm6871 T C 7: 41,547,761 T7A Het
Kank1 A G 19: 25,410,799 D612G possibly damaging Het
Lhcgr AT ATT 17: 88,742,249 probably null Het
Mfsd6 T A 1: 52,708,641 D355V probably benign Het
Myo7a T C 7: 98,063,639 K1710E probably benign Het
Olfr270 C G 4: 52,970,788 H56D probably damaging Het
Olfr608 A G 7: 103,470,252 D71G probably damaging Het
Pcdha8 G A 18: 36,993,211 V249M probably damaging Het
Pglyrp3 A G 3: 92,026,483 D145G probably benign Het
Pkhd1l1 A G 15: 44,546,659 K2521E possibly damaging Het
Pld3 A G 7: 27,532,661 V398A probably damaging Het
Plxnb1 A T 9: 109,112,078 T1642S probably damaging Het
Ppp2r1a T G 17: 20,959,438 V348G possibly damaging Het
Prdm2 C A 4: 143,132,733 C1329F possibly damaging Het
Ric8a G T 7: 140,861,356 G423V probably damaging Het
Rnf17 A G 14: 56,421,136 D94G probably benign Het
Serpina3f T C 12: 104,219,510 F325L probably damaging Het
Sin3a T A 9: 57,127,284 V1247E possibly damaging Het
Skint5 C A 4: 113,940,890 M165I probably benign Het
Slc19a3 T G 1: 83,022,495 Y267S probably damaging Het
Slc22a27 A T 19: 7,910,025 F196Y possibly damaging Het
Tbc1d9 T A 8: 83,255,890 V768E probably damaging Het
Tex15 T A 8: 33,573,506 M988K probably benign Het
Top2b T A 14: 16,393,291 F317I probably damaging Het
Wfdc8 A T 2: 164,597,535 L309* probably null Het
Wipf1 G A 2: 73,437,535 P173L possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp949 C T 9: 88,570,000 T541I probably benign Het
Zkscan16 T A 4: 58,952,407 I235N probably benign Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 76070588 missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 76070495 splice site probably benign
IGL01754:Slc5a4b APN 10 76070615 missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 76060426 missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 76060354 missense probably benign 0.01
IGL02211:Slc5a4b APN 10 76060463 splice site probably benign
IGL02254:Slc5a4b APN 10 76060430 missense probably benign
IGL02389:Slc5a4b APN 10 76072465 nonsense probably null
IGL02427:Slc5a4b APN 10 76058879 missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 76075015 missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 76110851 missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 76075100 missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 76070628 missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 76062283 missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 76081327 missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 76090700 missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 76064036 missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 76081507 missense probably benign 0.09
R0975:Slc5a4b UTSW 10 76081407 missense probably benign 0.09
R1934:Slc5a4b UTSW 10 76081473 missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 76108549 missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 76075073 missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 76081524 missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 76062260 missense probably benign 0.01
R4012:Slc5a4b UTSW 10 76074992 missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 76058891 nonsense probably null
R4667:Slc5a4b UTSW 10 76075045 missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 76062239 missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 76081467 missense probably benign 0.44
R5181:Slc5a4b UTSW 10 76060387 nonsense probably null
R5319:Slc5a4b UTSW 10 76062399 missense probably benign 0.08
R6306:Slc5a4b UTSW 10 76081351 missense probably benign 0.01
R6422:Slc5a4b UTSW 10 76103862 missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 76062386 missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 76089978 missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 76075109 missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 76110908 missense probably benign 0.01
R7683:Slc5a4b UTSW 10 76064072 missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 76070573 missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 76062299 missense probably benign 0.19
R7877:Slc5a4b UTSW 10 76075052 missense probably damaging 1.00
X0019:Slc5a4b UTSW 10 76110851 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGTAGGGTTAGATGGCTTATACTTC -3'
(R):5'- GTCCACAGACTATGCAAGGG -3'

Sequencing Primer
(F):5'- AGGTTCAGGCGTCTACAT -3'
(R):5'- CCACAGACTATGCAAGGGTTTTG -3'
Posted On2020-06-30