Incidental Mutation 'R0294:Dock8'
ID26320
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Namededicator of cytokinesis 8
SynonymsA130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0294 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location24999529-25202432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25188350 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1866 (I1866T)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
PDB Structure
Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025831
AA Change: I1866T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: I1866T

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Il5ra A T 6: 106,712,401 M410K probably benign Het
Ints7 A G 1: 191,611,891 S548G possibly damaging Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mgst2 A G 3: 51,681,830 Y88C probably damaging Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Nnt T A 13: 119,336,267 Y719F probably benign Het
Nnt T G 13: 119,338,417 I659L possibly damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr506 A T 7: 108,613,150 Y281F probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Slc5a4b A G 10: 76,081,327 C292R probably damaging Het
Sphkap T A 1: 83,278,245 E594D possibly damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
X0027:Dock8 UTSW 19 25161129 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGGCAGATTCTGAACTCCCTC -3'
(R):5'- AGGCTCCCTCTTCCCGAAAGTG -3'

Sequencing Primer
(F):5'- CTGAACTCCCTCCCGCC -3'
(R):5'- GGGCGCATTACCTCCTC -3'
Posted On2013-04-16