Incidental Mutation 'R0294:Ints7'
ID26263
Institutional Source Beutler Lab
Gene Symbol Ints7
Ensembl Gene ENSMUSG00000037461
Gene Nameintegrator complex subunit 7
Synonyms5930412E23Rik
MMRRC Submission 038511-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R0294 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191575636-191623688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 191611891 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 548 (S548G)
Ref Sequence ENSEMBL: ENSMUSP00000036277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000194785] [ENSMUST00000194877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045450
AA Change: S548G

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: S548G

DomainStartEndE-ValueType
SCOP:d1gw5a_ 76 530 1e-10 SMART
low complexity region 937 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193961
Predicted Effect probably benign
Transcript: ENSMUST00000194785
Predicted Effect probably benign
Transcript: ENSMUST00000194877
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Aadat A G 8: 60,534,608 E319G possibly damaging Het
Abca13 A G 11: 9,269,122 probably null Het
Actl7b A T 4: 56,740,848 L170Q possibly damaging Het
Adam29 C A 8: 55,873,276 V48L probably benign Het
Aknad1 A G 3: 108,775,192 Y528C probably damaging Het
Alas1 T A 9: 106,241,256 K222N probably damaging Het
Aplf A G 6: 87,646,245 V284A probably benign Het
Atp11a G A 8: 12,827,524 V317M probably benign Het
Bub3 A G 7: 131,568,224 E206G possibly damaging Het
Cblb T G 16: 52,135,824 F263L probably damaging Het
Ces2h T A 8: 105,016,604 M157K probably benign Het
Cfh A G 1: 140,183,261 F6L probably benign Het
Chst1 G T 2: 92,613,642 R153L probably damaging Het
Cntnap5a T A 1: 115,915,316 N121K probably benign Het
Crybg1 A T 10: 43,986,376 S1467R probably damaging Het
Cyp2d22 A G 15: 82,374,445 F72L possibly damaging Het
Dmrt2 C T 19: 25,678,071 P345S probably damaging Het
Dock8 T C 19: 25,188,350 I1866T probably damaging Het
Egfem1 A G 3: 29,690,121 N503S probably damaging Het
Ehbp1 T C 11: 22,095,427 D774G probably benign Het
Foxp2 C A 6: 15,376,774 probably benign Het
Gins3 T C 8: 95,637,919 V99A possibly damaging Het
Gm597 T C 1: 28,778,663 Q96R probably benign Het
Grm1 A T 10: 11,080,399 I47N probably damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Hsdl2 T A 4: 59,601,408 S127T probably benign Het
Il5ra A T 6: 106,712,401 M410K probably benign Het
Kcnt1 A G 2: 25,888,110 E80G probably damaging Het
Lexm T C 4: 106,613,164 D232G probably damaging Het
Lgr6 A G 1: 134,987,891 V373A probably damaging Het
Lgr6 T A 1: 135,105,061 Q27L unknown Het
Map3k14 T C 11: 103,227,137 I610V possibly damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Metap1d T A 2: 71,522,545 H239Q probably benign Het
Mgst2 A G 3: 51,681,830 Y88C probably damaging Het
Mroh4 T C 15: 74,606,149 N903D probably benign Het
Nbeal2 T G 9: 110,632,859 D1476A probably damaging Het
Nlgn1 C A 3: 26,133,476 A87S probably benign Het
Nln C T 13: 104,052,579 G295S probably damaging Het
Nnt T A 13: 119,336,267 Y719F probably benign Het
Nnt T G 13: 119,338,417 I659L possibly damaging Het
Olfr1006 A G 2: 85,674,716 V145A probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr506 A T 7: 108,613,150 Y281F probably damaging Het
Olfr605 G A 7: 103,443,084 T13I possibly damaging Het
Olfr64 A T 7: 103,892,930 H268Q probably benign Het
Otogl C T 10: 107,777,228 C2041Y probably damaging Het
Patj G T 4: 98,497,048 D300Y probably damaging Het
Pkhd1l1 A T 15: 44,560,435 E3124D probably benign Het
Plbd2 A G 5: 120,487,449 probably null Het
Pphln1 T C 15: 93,420,290 Y57H probably damaging Het
Ppp1r16b C T 2: 158,746,603 T78M probably damaging Het
Prss40 T G 1: 34,556,081 D224A possibly damaging Het
Senp6 A G 9: 80,113,725 probably null Het
Shank3 A G 15: 89,532,098 E666G probably damaging Het
Slc13a1 T A 6: 24,090,780 I547F possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a18 G A 7: 143,492,841 probably null Het
Slc5a4b A G 10: 76,081,327 C292R probably damaging Het
Sphkap T A 1: 83,278,245 E594D possibly damaging Het
Srpr T A 9: 35,215,515 M61K probably damaging Het
Trmt10c A T 16: 56,034,877 Y132N possibly damaging Het
Other mutations in Ints7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ints7 APN 1 191596164 splice site probably null
IGL01285:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01289:Ints7 APN 1 191615778 missense probably benign 0.00
IGL01572:Ints7 APN 1 191615793 missense possibly damaging 0.71
IGL01665:Ints7 APN 1 191613219 splice site probably benign
IGL02059:Ints7 APN 1 191615760 missense probably benign 0.23
IGL02684:Ints7 APN 1 191613637 critical splice acceptor site probably null
IGL02686:Ints7 APN 1 191586592 missense probably damaging 1.00
IGL02812:Ints7 APN 1 191619741 missense probably damaging 1.00
IGL03119:Ints7 APN 1 191610365 missense probably damaging 1.00
IGL03162:Ints7 APN 1 191621412 utr 3 prime probably benign
PIT4810001:Ints7 UTSW 1 191596236 missense probably damaging 0.99
R0479:Ints7 UTSW 1 191614554 intron probably null
R0698:Ints7 UTSW 1 191594464 missense probably damaging 0.97
R1420:Ints7 UTSW 1 191613057 missense possibly damaging 0.73
R1680:Ints7 UTSW 1 191621162 splice site probably null
R1781:Ints7 UTSW 1 191596284 missense possibly damaging 0.95
R2141:Ints7 UTSW 1 191604860 missense possibly damaging 0.73
R2291:Ints7 UTSW 1 191606203 synonymous probably null
R4718:Ints7 UTSW 1 191583277 missense possibly damaging 0.60
R4741:Ints7 UTSW 1 191619635 missense probably benign 0.29
R4797:Ints7 UTSW 1 191596933 missense probably damaging 1.00
R4812:Ints7 UTSW 1 191594430 missense possibly damaging 0.73
R4826:Ints7 UTSW 1 191611906 missense probably damaging 0.97
R4870:Ints7 UTSW 1 191596331 missense probably damaging 0.97
R5169:Ints7 UTSW 1 191613090 missense probably benign 0.00
R5281:Ints7 UTSW 1 191615771 missense possibly damaging 0.90
R5694:Ints7 UTSW 1 191586618 missense probably damaging 1.00
R5752:Ints7 UTSW 1 191575893 missense probably benign 0.00
R6048:Ints7 UTSW 1 191621412 utr 3 prime probably benign
R6341:Ints7 UTSW 1 191613127 missense probably damaging 1.00
R6419:Ints7 UTSW 1 191602302 missense possibly damaging 0.69
R7037:Ints7 UTSW 1 191619605 missense probably benign 0.16
R7163:Ints7 UTSW 1 191617837 missense possibly damaging 0.67
R7603:Ints7 UTSW 1 191596224 missense probably damaging 1.00
R7801:Ints7 UTSW 1 191615747 missense possibly damaging 0.84
R7899:Ints7 UTSW 1 191621315 missense probably damaging 1.00
R8034:Ints7 UTSW 1 191613068 frame shift probably null
R8034:Ints7 UTSW 1 191613071 frame shift probably null
R8231:Ints7 UTSW 1 191596353 nonsense probably null
R8251:Ints7 UTSW 1 191621433 missense unknown
Z1177:Ints7 UTSW 1 191610458 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGAGCATAGACTGCAATGCTGAC -3'
(R):5'- GAGGCGATCCCTTTGTGGTAGAAC -3'

Sequencing Primer
(F):5'- AAGGTCCTGAGTGCCATTCAC -3'
(R):5'- CCCTTTGTGGTAGAACTTCAAAGAC -3'
Posted On2013-04-16