Incidental Mutation 'R7463:Ncapg'
ID 605551
Institutional Source Beutler Lab
Gene Symbol Ncapg
Ensembl Gene ENSMUSG00000015880
Gene Name non-SMC condensin I complex, subunit G
Synonyms 5730507H05Rik, MFT.M05.13, Hcapg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R7463 (G1)
Quality Score 92.0077
Status Validated
Chromosome 5
Chromosomal Location 45669919-45700546 bp(+) (GRCm38)
Type of Mutation splice site (166 bp from exon)
DNA Base Change (assembly) T to A at 45694092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045586] [ENSMUST00000117396] [ENSMUST00000190036]
AlphaFold E9PWG6
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117396
SMART Domains Protein: ENSMUSP00000112871
Gene: ENSMUSG00000015880

DomainStartEndE-ValueType
Pfam:Cnd3 557 863 7.4e-87 PFAM
low complexity region 864 874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,772 V435E probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adcy2 T C 13: 68,730,280 D413G probably damaging Het
Adgrg6 T A 10: 14,434,396 D727V possibly damaging Het
Aebp2 C T 6: 140,637,726 Q309* probably null Het
Amy1 A T 3: 113,569,884 C43* probably null Het
Bpifc T C 10: 85,979,334 E256G probably benign Het
Bysl A T 17: 47,602,471 S296T probably benign Het
Carmil3 C T 14: 55,502,396 P980L probably damaging Het
Coch T A 12: 51,593,625 M1K probably null Het
Cpt2 A T 4: 107,908,157 F137I probably damaging Het
Crem T C 18: 3,295,094 I112V probably benign Het
Cul9 A G 17: 46,520,476 probably null Het
Cyp3a41a T A 5: 145,713,564 I90F probably damaging Het
Cyp4f16 C T 17: 32,550,787 A457V possibly damaging Het
Ddx6 A G 9: 44,628,729 E318G probably damaging Het
Dip2b A G 15: 100,154,157 E213G probably benign Het
Dlx5 T C 6: 6,878,316 H238R probably damaging Het
Dnaic2 A C 11: 114,754,406 I556L probably benign Het
Dnmt1 C T 9: 20,912,225 V1147M possibly damaging Het
Egf G T 3: 129,740,015 Q59K probably benign Het
Ermp1 A T 19: 29,646,262 Y109* probably null Het
Fer1l6 T A 15: 58,573,601 Y573* probably null Het
Fmnl1 T C 11: 103,193,128 L503P probably damaging Het
Gnptab T G 10: 88,431,389 I447M probably damaging Het
Hgf G A 5: 16,578,450 D253N probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Igf2r T C 17: 12,710,645 T958A probably benign Het
Kcnd2 T A 6: 21,216,498 L67Q probably damaging Het
Kif5a A G 10: 127,243,724 V248A probably damaging Het
Krt33b A G 11: 100,029,563 I88T probably damaging Het
Lhx2 G A 2: 38,351,846 E25K possibly damaging Het
Mex3d C T 10: 80,381,698 G562R Het
Myom2 A T 8: 15,117,679 Y1088F probably null Het
Nudc A C 4: 133,534,403 V190G possibly damaging Het
Obscn G T 11: 59,122,860 R1054S probably benign Het
Olfr1045 T C 2: 86,197,838 M305V probably benign Het
Olfr1510 A G 14: 52,410,711 W54R probably benign Het
Olfr651 T C 7: 104,553,482 S188P possibly damaging Het
Olfr683 T A 7: 105,143,937 M119L probably benign Het
Olfr710 A T 7: 106,944,173 V276E probably damaging Het
Olfr979 A G 9: 40,000,564 V221A probably benign Het
Pcdh10 A T 3: 45,383,572 R891S possibly damaging Het
Pcdh15 C T 10: 74,631,770 S1873L possibly damaging Het
Pcdh7 A G 5: 57,720,998 K632E probably benign Het
Pcdhgb8 G A 18: 37,763,427 A517T probably damaging Het
Ptgr2 A T 12: 84,292,298 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Racgap1 T A 15: 99,642,958 T4S probably benign Het
Rb1cc1 A G 1: 6,249,180 H941R probably benign Het
Reln T C 5: 22,103,435 H312R probably damaging Het
Rnf166 T A 8: 122,467,987 H208L probably damaging Het
Theg T C 10: 79,576,715 E314G probably damaging Het
Timeless T C 10: 128,250,426 S999P probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tor1aip1 A T 1: 156,007,609 H349Q possibly damaging Het
Ttn T A 2: 76,920,460 E3415V probably benign Het
Vmn2r102 A T 17: 19,676,624 N78Y probably damaging Het
Wdr11 A T 7: 129,607,086 D427V probably damaging Het
Zer1 A T 2: 30,113,437 probably benign Het
Zfp516 T A 18: 82,957,108 M477K probably benign Het
Other mutations in Ncapg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ncapg APN 5 45693160 missense possibly damaging 0.53
IGL00777:Ncapg APN 5 45695765 missense possibly damaging 0.93
IGL00857:Ncapg APN 5 45676585 splice site probably null
IGL00916:Ncapg APN 5 45671192 missense probably benign 0.37
IGL01293:Ncapg APN 5 45681854 missense probably benign 0.01
IGL01360:Ncapg APN 5 45674385 nonsense probably null
IGL01462:Ncapg APN 5 45671135 missense probably benign 0.02
IGL01527:Ncapg APN 5 45672384 missense possibly damaging 0.71
IGL01732:Ncapg APN 5 45693853 missense probably damaging 1.00
IGL01788:Ncapg APN 5 45671081 missense probably damaging 0.97
IGL01871:Ncapg APN 5 45688581 missense probably benign 0.09
IGL03106:Ncapg APN 5 45695668 missense probably damaging 1.00
IGL03124:Ncapg APN 5 45671209 missense probably benign
R0086:Ncapg UTSW 5 45676744 splice site probably null
R0109:Ncapg UTSW 5 45693748 splice site probably null
R0110:Ncapg UTSW 5 45693147 unclassified probably benign
R0377:Ncapg UTSW 5 45693817 missense probably benign
R0432:Ncapg UTSW 5 45672428 missense probably damaging 0.99
R0637:Ncapg UTSW 5 45687324 missense probably damaging 1.00
R0835:Ncapg UTSW 5 45681448 missense probably damaging 0.96
R0894:Ncapg UTSW 5 45679894 missense probably null 0.24
R1069:Ncapg UTSW 5 45675930 intron probably benign
R1216:Ncapg UTSW 5 45699919 missense possibly damaging 0.68
R1967:Ncapg UTSW 5 45699910 missense probably damaging 0.99
R2396:Ncapg UTSW 5 45678373 missense probably benign 0.00
R3157:Ncapg UTSW 5 45676058 missense probably benign
R3735:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3736:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3887:Ncapg UTSW 5 45674363 missense probably benign
R4371:Ncapg UTSW 5 45678455 missense probably benign
R4545:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4546:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4558:Ncapg UTSW 5 45676644 missense probably benign 0.00
R4615:Ncapg UTSW 5 45687399 missense probably benign 0.00
R4938:Ncapg UTSW 5 45671209 missense probably benign
R5839:Ncapg UTSW 5 45672278 missense probably damaging 0.99
R5871:Ncapg UTSW 5 45695697 missense probably damaging 1.00
R6086:Ncapg UTSW 5 45693236 missense probably damaging 1.00
R6418:Ncapg UTSW 5 45681816 missense probably damaging 1.00
R6617:Ncapg UTSW 5 45670132 missense probably benign 0.03
R7145:Ncapg UTSW 5 45670030 missense possibly damaging 0.82
R7408:Ncapg UTSW 5 45695793 missense probably benign 0.00
R7443:Ncapg UTSW 5 45672310 missense probably benign 0.31
R7509:Ncapg UTSW 5 45696108 missense probably benign 0.01
R7687:Ncapg UTSW 5 45699885 missense probably benign 0.03
R7919:Ncapg UTSW 5 45696048 missense probably benign 0.00
R8022:Ncapg UTSW 5 45681794 missense probably damaging 1.00
R8177:Ncapg UTSW 5 45693753 missense probably benign 0.00
R8261:Ncapg UTSW 5 45687388 missense possibly damaging 0.90
R8263:Ncapg UTSW 5 45691792 missense probably benign 0.44
R8324:Ncapg UTSW 5 45695668 missense probably damaging 1.00
R8333:Ncapg UTSW 5 45674463 missense probably damaging 0.96
R8742:Ncapg UTSW 5 45693874 missense probably damaging 1.00
R9026:Ncapg UTSW 5 45695773 missense probably benign 0.00
R9051:Ncapg UTSW 5 45695798 missense probably damaging 1.00
R9076:Ncapg UTSW 5 45676641 missense probably benign
R9122:Ncapg UTSW 5 45688673 missense possibly damaging 0.95
RF019:Ncapg UTSW 5 45698856 missense probably benign 0.00
Z1088:Ncapg UTSW 5 45679880 missense probably damaging 1.00
Z1177:Ncapg UTSW 5 45672502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGAAGTAGATGTCACAAATGTTG -3'
(R):5'- GCAAGCCAACATTTGCAGACG -3'

Sequencing Primer
(F):5'- TCCTAAGGCAAAGAATTCTCAGG -3'
(R):5'- CTCACTAAGTGGGGAGAA -3'
Posted On 2019-12-13