Incidental Mutation 'R3077:Pdzd8'
ID265270
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene NamePDZ domain containing 8
SynonymsA630041P07Rik, Pdzk8
MMRRC Submission 040567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3077 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location59296084-59345780 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 59305156 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
Predicted Effect probably null
Transcript: ENSMUST00000099274
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,267,605 I1981V probably benign Het
Adgrd1 A T 5: 129,129,105 I248F probably benign Het
Arfgef3 T C 10: 18,603,530 I1446V probably damaging Het
Cabcoco1 T G 10: 68,525,645 Y8S possibly damaging Het
Champ1 T C 8: 13,878,832 V330A probably benign Het
Dnajc8 A G 4: 132,544,663 D70G probably damaging Het
Kif14 T G 1: 136,519,645 I1396S possibly damaging Het
Mnt G C 11: 74,843,110 probably benign Het
Nhsl2 C T X: 102,077,595 R62W probably damaging Het
Olfr389 G A 11: 73,776,640 P229L possibly damaging Het
Olfr576 G T 7: 102,966,016 K305N probably benign Het
Pcdhb11 C T 18: 37,422,244 T209I probably benign Het
Phactr4 A G 4: 132,397,996 M1T probably null Het
Pwwp2a A G 11: 43,705,385 N184S probably damaging Het
Shprh T C 10: 11,170,413 V958A probably damaging Het
Smc3 A G 19: 53,627,891 E449G probably benign Het
Snap91 T A 9: 86,838,854 Y96F possibly damaging Het
Trim34b A G 7: 104,331,301 R199G possibly damaging Het
Unc45a A C 7: 80,338,932 V112G probably damaging Het
Vwa8 A T 14: 79,098,342 N1413Y probably benign Het
Zcchc9 A T 13: 91,805,982 N51K probably benign Het
Zfp628 A G 7: 4,921,200 E807G possibly damaging Het
Zfp647 A T 15: 76,918,009 M1K probably null Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59345286 missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACAAGCATGCTAAGGCCTC -3'
(R):5'- GTCACAATGATTTAAAAGTCACGAC -3'

Sequencing Primer
(F):5'- ACAAGCATGCTAAGGCCTCTTTTG -3'
(R):5'- GTCGGACTTACACTTCGT -3'
Posted On2015-02-05