Incidental Mutation 'R3086:Kif20b'
ID265657
Institutional Source Beutler Lab
Gene Symbol Kif20b
Ensembl Gene ENSMUSG00000024795
Gene Namekinesin family member 20B
SynonymsKif20b, Mphosph1, N-6 kinesin
MMRRC Submission 040575-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R3086 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34922361-34975745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34929715 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 128 (F128S)
Ref Sequence ENSEMBL: ENSMUSP00000152994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223776] [ENSMUST00000223907] [ENSMUST00000225408]
Predicted Effect probably damaging
Transcript: ENSMUST00000087341
AA Change: F128S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795
AA Change: F128S

DomainStartEndE-ValueType
Blast:KISc 2 46 5e-15 BLAST
KISc 56 483 1.19e-103 SMART
low complexity region 521 551 N/A INTRINSIC
coiled coil region 565 602 N/A INTRINSIC
coiled coil region 705 746 N/A INTRINSIC
coiled coil region 823 947 N/A INTRINSIC
coiled coil region 1020 1325 N/A INTRINSIC
coiled coil region 1348 1510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223776
AA Change: F128S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223907
AA Change: F128S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224603
Predicted Effect probably benign
Transcript: ENSMUST00000225408
Meta Mutation Damage Score 0.4711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,955 L48P probably damaging Het
4932438A13Rik A G 3: 37,011,703 D3483G possibly damaging Het
Adgra3 A T 5: 50,013,391 probably null Het
Alms1 A G 6: 85,678,140 R3223G probably benign Het
Cabyr T C 18: 12,750,966 V170A probably damaging Het
Ces2b A T 8: 104,832,769 D89V possibly damaging Het
Dhrs2 G T 14: 55,239,844 V179L probably benign Het
Dlg5 T C 14: 24,166,190 T595A probably damaging Het
Dock10 T C 1: 80,532,357 N1585D possibly damaging Het
Dock4 T C 12: 40,731,863 I689T probably benign Het
Fgfr4 G T 13: 55,167,392 probably benign Het
Frk G A 10: 34,607,954 G437D probably damaging Het
Frzb T G 2: 80,418,514 I199L possibly damaging Het
Gsg1l C T 7: 125,891,680 R284H probably benign Het
Helq A G 5: 100,773,992 L782S probably benign Het
Kifc2 T C 15: 76,667,252 F725L probably benign Het
Lekr1 A G 3: 65,727,160 noncoding transcript Het
Macf1 T A 4: 123,435,108 M2490L probably benign Het
Megf8 T A 7: 25,349,019 Y1706N probably damaging Het
N4bp2 A G 5: 65,791,053 Y342C probably damaging Het
Nf1 T C 11: 79,546,986 C2057R probably damaging Het
Olfr1280 A G 2: 111,316,116 I212M probably benign Het
Olfr1313 C A 2: 112,071,975 G203* probably null Het
Olfr794 G A 10: 129,571,407 G251S probably damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdha1 G C 18: 36,930,948 E222Q possibly damaging Het
Prune2 A T 19: 17,121,413 D1427V possibly damaging Het
Rnps1 C T 17: 24,412,419 probably benign Het
Rsph4a G C 10: 33,909,202 V370L probably damaging Het
Sema5b T A 16: 35,622,723 S33T probably benign Het
Stk-ps2 A C 1: 46,029,076 noncoding transcript Het
Tep1 A T 14: 50,827,054 probably null Het
Tet1 T C 10: 62,879,621 K132E probably benign Het
Tiam2 A G 17: 3,421,582 K500E probably damaging Het
Tmem131l G T 3: 83,931,739 R635S probably benign Het
Tmem68 T C 4: 3,569,594 E32G possibly damaging Het
Vmn2r101 T A 17: 19,588,815 probably null Het
Zfp780b A G 7: 27,963,630 I500T probably damaging Het
Zfyve26 G T 12: 79,265,683 probably benign Het
Other mutations in Kif20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kif20b APN 19 34947660 missense possibly damaging 0.77
IGL01021:Kif20b APN 19 34938260 missense possibly damaging 0.89
IGL01590:Kif20b APN 19 34954726 missense possibly damaging 0.87
IGL01691:Kif20b APN 19 34935743 splice site probably benign
IGL01730:Kif20b APN 19 34950523 nonsense probably null
IGL02078:Kif20b APN 19 34935644 missense probably damaging 1.00
IGL02174:Kif20b APN 19 34934458 splice site probably benign
IGL02536:Kif20b APN 19 34974559 missense probably benign 0.42
IGL03029:Kif20b APN 19 34950913 missense probably benign
IGL03186:Kif20b APN 19 34934944 missense probably benign 0.45
IGL03205:Kif20b APN 19 34959463 missense probably damaging 1.00
IGL03493:Kif20b APN 19 34959550 nonsense probably null
R0319:Kif20b UTSW 19 34947732 splice site probably benign
R1069:Kif20b UTSW 19 34950851 missense probably damaging 1.00
R1137:Kif20b UTSW 19 34937086 critical splice donor site probably null
R1255:Kif20b UTSW 19 34950106 missense probably benign 0.08
R1352:Kif20b UTSW 19 34924635 missense probably benign
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1473:Kif20b UTSW 19 34974496 missense possibly damaging 0.93
R1545:Kif20b UTSW 19 34928918 missense probably damaging 1.00
R1647:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1648:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1752:Kif20b UTSW 19 34938336 missense probably benign 0.13
R1835:Kif20b UTSW 19 34956038 missense probably damaging 1.00
R1889:Kif20b UTSW 19 34941208 unclassified probably benign
R1937:Kif20b UTSW 19 34952878 missense possibly damaging 0.73
R2112:Kif20b UTSW 19 34931732 missense probably benign 0.04
R2315:Kif20b UTSW 19 34931599 missense probably damaging 1.00
R2385:Kif20b UTSW 19 34959419 missense probably damaging 0.98
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R3116:Kif20b UTSW 19 34970080 missense probably benign 0.38
R3407:Kif20b UTSW 19 34950500 missense probably damaging 1.00
R3834:Kif20b UTSW 19 34935028 missense probably damaging 1.00
R3882:Kif20b UTSW 19 34950080 missense probably damaging 1.00
R4698:Kif20b UTSW 19 34951544 missense probably damaging 1.00
R4721:Kif20b UTSW 19 34938373 missense probably benign 0.41
R4883:Kif20b UTSW 19 34966122 missense probably benign 0.00
R4901:Kif20b UTSW 19 34934436 missense probably benign 0.00
R4923:Kif20b UTSW 19 34941211 critical splice acceptor site probably null
R5538:Kif20b UTSW 19 34952964 nonsense probably null
R5540:Kif20b UTSW 19 34938460 missense probably benign 0.01
R5558:Kif20b UTSW 19 34951549 missense probably damaging 1.00
R5580:Kif20b UTSW 19 34949728 splice site probably null
R5934:Kif20b UTSW 19 34941321 missense probably benign 0.02
R6019:Kif20b UTSW 19 34950464 missense probably benign 0.00
R6464:Kif20b UTSW 19 34934441 missense probably benign
R6613:Kif20b UTSW 19 34936984 nonsense probably null
R6745:Kif20b UTSW 19 34928876 missense possibly damaging 0.94
R7097:Kif20b UTSW 19 34974492 missense probably damaging 0.98
R7237:Kif20b UTSW 19 34950605 missense probably damaging 1.00
R7260:Kif20b UTSW 19 34950210 missense probably damaging 1.00
R7373:Kif20b UTSW 19 34935671 missense probably damaging 1.00
R7418:Kif20b UTSW 19 34929687 missense probably damaging 0.99
R7814:Kif20b UTSW 19 34950955 missense possibly damaging 0.63
R7861:Kif20b UTSW 19 34939922 missense probably damaging 1.00
R7944:Kif20b UTSW 19 34939922 missense probably damaging 1.00
Z1088:Kif20b UTSW 19 34950451 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCCTGGATGTGTGAGTTTTCT -3'
(R):5'- TGATGGAAATATTATGACATCATTGGG -3'

Sequencing Primer
(F):5'- TTAGACTTACTGGCAGGCAC -3'
(R):5'- CCAGAATTGGTCAGACCATA -3'
Posted On2015-02-05